(c) Darkside Oct 2000
'There is a greater darkness than the one we fight. It is the
darkness of the soul that has lost its way. The war we fight is not
against powers and principalities. It is against chaos and
despair! Greater than the death of flesh is the death of hope, the
death of dreams. Against this peril we can never surrender. The
future is all around us, waiting in moments of transition to be
born in moments of revelation. No one knows the shape of that
future or where it will take us. We know only that it is always
born in pain."
J Michael Straczynski
Prologue.
--------------
The showers that had been threatening that morning had now
developed into a full scale thunderstorm, a fact that did not deter
the two women and a man standing near an open graveside.
The smaller of the two women clasped hold of the man's hand
and put her head on his shoulder. The other woman towered
above them both, her blonde hair tied back into a ponytail and
she was holding a large golfing style umbrella, which was doing
it's best to keep the cortege dry.
From across the other side of the graveyard a man dressed in a
brown raincoat looked on at the proceedings thru his miniature
binoculars. The man brushed away a tear as he saw the other
man slowly stoop down and place a single red rose into the
open grave. The two women repeated the gesture and then
drew each other into a comforting embrace.
A cell phone inside the man's coat pocket interrupted his
thoughts and he quickly reached inside to answer it, "Hello?"
"Friday, this is Heinlein are you ready to proceed?"
"Can I just have a few more minutes?" the man asked.
"You're needed to pick up the merchandise now."
"Ok will do, Heinlein?"
"Yes Friday?"
"You're a bastard!" the man said bitterly and disconnected the
call. Placing the cell phone back in his pocket the man gave
another sigh. 'Only fifteen more years to go', he thought. But
then, what's fifteen years when you have at least another
century.
-- o -- o -- o --
Fifteen Years Later.
---------------------------
A young girl sat sobbing in her room. Her long auburn hair was
in disarray and swept in front of her face. Still crying, the girl
rubbed her eyes and flopped back onto the bed.
A few minutes later there was a knock at the door. "Elizabeth,
can I come in?" a female voice asked.
"If you have to mom," Elizabeth replied with an edge of
sarcasm.
The door opened and in walked a woman of about forty. She
had pale olive brown skin, deep brown eyes and her silky long
black hair was tied back into an elegant ponytail. She was
greeted by a cold, hard stare from the girl's blue/gray eyes. The
ferocity of the stare sent shivers down the woman's spine, it was a stare
that brought back so many horrific memories. Composing
herself, she sat down by the bed and put a motherly hand on
the girl's leg. The women then started to talk. Her voice was full
of concern and tenderness, "Elizabeth, we thought you had the
right to know. We were waiting for the chance to tell you. We're
just sorry you just had to find out like this."
"When were you going to tell me? When I was about to
get married? When I was fifty? I mean being an identical copy of
one of the most feared women of the last century isn't
something you happen to drop into a mother-daughter chat, is
it!" Elizabeth gave her mother another soul piercing stare.
"Actually we had decided that eighteen was the best age,
sooner, if you were up to knowing. I guess fifteen isn't a bad age to
find out either. The point is, is we love you no matter who you are.
It doesn't matter to me, your dad, Auntie Cathline and to anyone
who knows you or us. The only people who would care are those
who might like to make a sensational story and some dirty money
out of it. The rest of the world has no idea who you are and
they never will, I promise."
"If I can suss it out someone else can, and then where would
that leave me? I'd be imprisoned right away, for the good of
society. Now I know why you make me take my medicine every
day. I always thought it was to stop my asthma. I don't even
have asthma so it turns out. It's not asthma medicine is it? It's
Olanzapine. That's not an asthma medicine! It's for controlling
schizophrenia. That's how I found out. I saw the prescription!"
Elizabeth cried.
Elizabeth heard a set of footsteps walking towards the door.
That'll be Dad she thought, "Come in Dad."
A tall man with blonde hair, streaked with gray strode in. "Hello
little mite' he said softly.
"Don't you little mite me! I know what you and mom kept from
me! I thought you loved me. I thought you cared for me! I hate
you and if you think I'm taking any more medicine ever..."
Elizabeth brushed her mom's hand away from her leg and rose,
ready to storm out of the room.
Her dad's hand reached out, grabbed her arm and gently
sat her back down on the bed again. He then sat down beside
her and started to speak, "When we found out your mom was
pregnant and the circumstances in which you came to be we
had a choice."
"But she's not my real mom is she! The 'hell bitch' is isn't she?"
Elizabeth spat the words at her father.
"She's your biological mother, true. But she died a long time
ago. She didn't nurse you, bring you into the world, read you
stories in the middle of the night when you got scared. Dr Bexley
is maybe who you are genetically, but you're not her. I knew her
even before your mother did and you are nothing like her.
Please to God don't ever think you are capable of what she did,
because you're not and never will be!"
"Is that why you lied to me about my asthma medicine?
Quickly changing the subject Elizabeth's mother continued, "As I
was saying we had a decision to make. I either carried you to
term or had an abortion. Even though you weren't biologically
mine I loved you as though you were and I still do. You knew
where you came from, we told you that years ago"
Elizabeth's tone softened, "I can't call you mom can I? You told
me I was a clone of dad, not a clone of HER. Is that why you
had John, so that you could have a child of your own? You
couldn't have known this from the start. Dr Bexley would never
have told you. When did you find out?"
"I am your mom. And as for John that's just plain stupid. We love
both of you just the same. We found out about ten years ago.
As you know you get record scores on your SAT's, have a
reading age ten years above your actual one, and have an IQ of
above 160. Dr Bexley told us that you were Dad's clone and we
believed her. However since Dr Bexley's transformation drug left
the brain intact and only altered the body then there was no way
you could have gotten those scores if she was telling the truth.
We took you in for tests and found out that our suspicions
were correct."
Elizabeth's eyes welled up with tears once more, "That I'm the
clone of one of the most terrifying women of the 20th century.
Kat, why didn't you tell me earlier? Am I an exact clone? I read
that Dr Bexley had a genetic flaw in her brain that under certain
circumstances caused extreme psychopathic and homicidal
tendencies. Do I have that? Is that why you gave me
Olanzapine?"
Kat nodded, "I'm still your mom, we love you very deeply and
just as much as we love John. Yes you do have the same flaw
and yes that's why we give you Olanzapine, just in case."
-- o -- o -- o--
Five Years Later.
-------------------------
He was in the middle of a conversation when he saw her, such
was the effect of her on him that he immediately forgot what he
was talking about and watched her walk into the biological
sciences faculty. The cut of her skirt-pants was perfect and
allowed him to appreciate her slender and toned body as she
passed by.
"Hey Mark, did you know your PDA's crashed?"
"Sorry?" Mark said, his mind still on this mysterious woman he'd
just seen.
"You were way out there guy. I mean totally Jacko'd out," Wills
said.
Mark smiled a knowing smile back at Wills. They'd been friends
since kindergarten. By now they each knew the others every
whim, and foible, "I've never seen you look at a woman like that.
Sure looks as though you've got it bad," Wills continued.
"Got what bad?" Mark answered defensively.
Wills gave a grin and shrugged, "Never mind. You better reboot
your PDA, otherwise you'll lose the essay we were working on."
Mark flipped the small, oval shaped plastic object over and
quickly depressed the CTRL-ALT and DELETE buttons on the
side. He remembered his Dad telling him about the 'old days' of
QWERTY keyboards, mice and such like paraphernalia.
Standards died hard though and now the only remains of the
'old days were these three discrete red buttons. A few seconds
later and the Sony-Micro-Sun-Paq logo appeared on the screen
and the PDA was ready for work again.
"Better check that essay," Wills stated.
"Who was that?" Mark asked, still distracted by the memory of
the girl.
"Mark?" Wills queried.
"Sorry," Mark said and spoke to his PDA
"PDA, verify contents of memory"
After a few seconds A dulcet female voice replied, "Everything's
intact Mark. Do you want to backup your data?"
"PDA, Sure, how long till my next lecture?"
The PDA's voice replied, "Mark, your next lecture is in 10
minutes. From your current location it will take you 15 minutes to
get there. Do you want to mail the lecturer stating a reason for
your lateness?"
"Shit!" Marked exclaimed and then added, "PDA Don't bother, I'll
make it."
"See ya after hours?" Wills asked.
"Same place same time," Mark had time to call as he began to
sprint to his next lecture.
-- o -- o -- o --
The woman who had been Mark's focus of attention sat down at
large, fake mahogany desk. Hunting around in her purse, she
pulled out a sleeker, more expensive looking version of Mark's
PDA and switched it on.
A female voice, a smooth as a nightingale's song spoke out
from the PDA, "Good afternoon Anne, What can I do for you?"
"PDA, download the contents of the United Nations Marine
Biology reports on the Coral reefs around the Maldives for the
years 1995 until current day. Also give me status reports on the
revised Human Genome projects, post Fury Directive til current
day."
Anne paused, waiting for the PDA to catch up. Although
equipped with a terabyte molecular storage datacard it still took
a few seconds to store information. A few seconds later the PDA
replied, "Done."
"Ok. PDA, show me the status of my bank account, screen only,
apply private code 249 modulus 69. Password is, " Anne
paused for a few moments before typing the word 'Phoenix' into
the PDA's virtual keyboard.
The PDA flashed a large seven figure sum on screen. Anne
nodded in approval and then added, "PDA, show bank account
status private code 148 modulus 63. Password is," Anne typed
in the word 'daughter'
"Anne, your current bank account is one hundred and three
dollars and twenty four cents," The PDA replied.
"Thank's. PDA display contents of the reports you just
downloaded."
Anne sat back on her chair and started to read.
-- o -- o -- o --
Mark's tutorial dragged on forever; his mind was still on the girl
he'd just seen walk into the faculty building. Even though his
grades were borderline at best and this close to the end of his
Ph.D. he needed spectacular grades in order to even scrape a
pass. However, at this point in time none of this bothered him.
The girl going into the faculty building was all that mattered.
Mark day dreamed about the girl, how her hair fell in perfect
formation onto her shoulders, how her shape was contoured by
her skirt-pants. In his mind the girl performed a delicate pirouette,
showing every inch of her perfect form. He could imagine
running his fingers thru her blonde hair, the smell of her perfume
and most pleasing of all the sound of her voice. It was like music
from the gods. If Helen of Troy could speak it would be like this.
His mind moved deeper into his fantasy. She would, he decided
be like an iron fist in an ever so soft velvet glove. She would be
feminine, with all the little girl vulnerabilities but have a steel
backbone. She would be like the willow delicate, supple but
unbreakable in the strongest wind. She would be his shelter in
the storm and he, like the oak would be hers.
Still in his dream world Mark tried out various conversations with
her, examining each permutation in meticulous detail. They
ranged from a simple 'hi' in a corridor to flowers to her dorm,
with him dressed as a delivery clown. The way to her heart, he
decided was to make her laugh, because her laugh would
ensnare his heart and never let go.
The sound of chairs being moved backwards woke him from his
daydream, the tutorial was over already and he hadn't listened
to a word! Hopefully his PDA had got enough storage space to
record it and he could get the gist of it. Quickly packing up his
stuff and after making a quick excuse to Wills he sprinted off to
the library. She should still be there, she had to!
Breathless he bolted into the library, much to the disdain of the
librarian and looked around. She was nowhere to be seen. He
tried to look interested in the rows of books as if searching for a
vital fragment of information but in reality he was scanning the
mostly empty tables for a glimpse of her. A few minutes later,
his hopes shattered and his heart in pieces he walked out of the
library. She was gone!
Mark tried his best to hide his disappointment at not seeing the
girl again. His pride wouldn't let him play the lovesick teenager
and go to the girls dorm and ask about her but try as he might
he couldn't get the girl out of his mind. He thought about going
back into the library to ask around but he'd promised Wills he'd
go and check out the latest Kweepa and Rooney movie and
besides, he was due to go on a field trip to Egypt for a couple of
weeks tomorrow. Still, he thought there was plenty of semester
left to find her and it'd wait until he got back.
-- o -- o -- o --
"Here take a flyer miss," a well groomed young man pointed his
PDA at the object of Mark's daydreams. There was a small beep
and the man moved onto his next target.
The woman wished that somebody would invent an advertising
bypass function in a PDA but even her top of the range model
wasn't immune to online adverts and generally annoying
commercials. Reluctantly she looked down at the flyer that had
been placed in her PDA. The sight of it made her sick, she
hated cults. Especially this one, this one gave her the creeps and
chilled her to the bone.
The flyer said "
o She was the most misunderstood woman of the 20th
century.
o Her self sacrifice and compassion is a lesson to us
all.
o She gave up her one true love to show us how to love.
o Her life was a lesson on how to forgive and obtain
forgiveness.
o Do you want to learn to love? Do you want to learn to
forgive? Do you need forgiveness and inner peace?
If the answer is yes please call 'The Children of Bexley'
One person CAN make a difference.
http://www.come.to/children-of-bexley"
If she could have she would have torn the flyer up and thrown it
to the four winds but instead she deleted from her PDA, gave a
deep sad sigh and walked back to her dorm.
Sinking down onto her bed she thought back to the flyer. Seeing
it upset her more than she let on. Why did these people insist
on latching onto a woman who had been dead nearly thirty
years? Why couldn't they find another 20th century woman to
latch onto, Mother Theresa, Princess Diana, Anne Frank, just
anyone but Dr Elizabeth Bexley. Part of her wanted to attend
one of their meetings, to prove them wrong, to correct the error
of their ways, but deep down she knew it would be a futile
gesture. Anyway she had larger things to attend to, like her
upcoming move to England. Things were nearly ready and the
timetable had just been finalized. She would spend the first two
years of her doctorate in England and finish her final year
back in the USA. With no family ties, such a move was a no-
brainer. Wearily she picked up her PDA and started to read.
'The last thirty years has seen a dramatic reduction in the coral
surrounding the Maldives. It was determined back in the 1970's
that coral is the indicator to the ecological health of the Ocean.
Such a decline can only mean that the environmental death of
the Indian Ocean is less than sixty years away. This paper will
outline the rationale behind this statement'.
Unable to concentrate further she put the PDA down on the bed,
closed her eyes and dreamt of happier days to come. The trip to
England was two days away and she still had a lot to do.
-- o -- o -- o --
"And this will be your room, Miss Stephens," A small matronly
woman opened a large wooden door and gestured inside.
Elizabeth walked into the room called ,"lights," and was a little
surprised that the lights didn't slowly come on.
"Oh didn't I mention, we don't have voice activated appliances
here. Here just use the switch," the women gestured to a small
switch on the wall and as if to demonstrate her point flicked it
on.
"Switch? How quaint," Elizabeth said under her breath. The
room was how she expected a dorm at Cambridge to be. All old
world, dark wood and musty. Bookcases lined the wall, an old
fireplace with a sooty white marble hearth was against one wall.
The doors leading into the other rooms had a used look about
them and the green carpet had seen better days. The only clue
that this was now the 21st century was a Sony-Nintendo picture
screen on the far wall, apart from that the date could have been
anytime from the last two hundred years.
"If you follow me I'll show you to your room," the woman said,
pointing to one of the doors.
"This has got two bedrooms?" Elizabeth queried.
"Didn't your mother mention, you're going to have a roommate."
Elizabeth frowned, the last thing she needed was some prissy
English girl getting in the way. Still at least she was here, on her
own and about to embark on her greatest challenge to date.
Elizabeth said none of this, only "No she didn't but I'm sure it'll
be fine. Do you know her name?"
The woman gave a shrug, "No, All I know is that she's from
London."
"Which London, old or new?" Elizabeth queried.
"New I think. It's all the same place to me dear."
Elizabeth was already getting bored with inane British
conversation and decided to make her excuses. "If you don't
mind I've had a long trip and could really do with a shower and
some time to unpack. Do I need to sign in or anything?"
"No that's fine. I hope you've brought some warm clothes with
you, it talks about being chilly tonight," the woman said, not
really getting the message.
"I'll be fine," Elizabeth replied.
"I hope so. This is nothing like living on that Island of yours is it?
Mind you, I do feel jealous of you, y'know. With your parents
being so famous n all. I wanted to be famous, did I ever tell
you..."
Elizabeth desperately wanted to stop the conversation and
imagined reaching down the woman's throat and ripping her
tongue out. Instead, she smiled sweetly and replied, "I'm sorry I
really am very tired. I'm sure we'll get chance to talk some
more."
"Oh that would be nice, I always cook scones on Friday and
you're welcome to join me."
Elizabeth nodded and wondered what ripping out someone's
tongue would feel like , "That'd be nice. Goodbye."
"Cheerio, nice to meet you, " the woman said, and closed the
door behind her.
Taking a deep breath Elizabeth walked into her room and in
spite of herself flopped down onto the bed and fell asleep.
Elizabeth was awakened an indeterminate time later by
someone hammering on the door. Groggily she stretched out,
swung her legs off the bed and walked towards the door.
It wasn't until she had got closer she heard a male voice call out
"Hey Kiddo, I know you're in there. What's up sleepy head,
the English weather got you down already?"
The voice was followed by another staccato series of loud
bangs.
Elizabeth groaned inwardly, but decided to leave the comment
for when she opened the door. She wondered what kind of face
would best suit the moment and decided nonchalant disdain
would send the right kind of message. With all necessary
measures in place she opened the door.
Standing in front of her was a tall, olive skinned man with deep
brown eyes, raven black hair, and a confident looking grin on his
face. He was wearing the latest Beckham-Kline shirt with its
wide collar and triple breasted pockets and she noted the now
traditional Neo-UV sunglasses poking out of one of the pockets.
"Hi Kiddo. Pleased to see me?" the man's rich, deep voice
asked. After the question the man's eyes gave a mischievous
twinkle and he broke out into a broad disarming smile. The
bright white teeth showing in start contrast to the dark olive skin.
Elizabeth couldn't help but smile. He ALWAYS did that to her.
She'd get all wound up, ready to unleash some devastating put
down; but when she tried to launch it, it just died somehow. All
she could manage to say was "Oh Hi it's you. You on your
own?"
The man gave another knowing smile. "Who else calls you
kiddo? Mom's here as well, she just parking the car."
Elizabeth tried her best to emulate the disarming smile, but she
knew she couldn't really pull it off. "And you can cut the kiddo
crap out as well. You're only four months older than me anyhow.
You'd better come in. I've not had chance to unpack yet so I
can't offer you much in the way of a drink."
"So'k we were well fed on the starplane."
"You got to go on one of those? I thought there wasn't a regular
service yet?" Elizabeth stated. The boredom and stress of a
nine hour flight from New York hadn't yet subsided.
"Mom pulled a few strings. It was out of this world. You take off
from JFK like a normal jet, climb to 50,000 feet and then WHAM
the ramjet kicks in until you're nearly in low orbit. You get
another WHAM when the rocket part of the engine kicks in and
presto New York to London in under an hour. They say it'll do
NY to Sydney in under two. A-F-ing-mazing. Brits invented the
thing too, years ago just nobody wanted to put money into it."
"You make me sick. You always manage to go one better don't
you." Elizabeth said jokingly.
"Hey that's what I'm here for."
"AND it helps that your mom is Rachel Martin doesn't it?"
"That too. Hey I'm really tired after my 50 minute flight. Can I sit
down?" the man asked, and gave a long false yawn.
"Sure, you can see where the sofa is", Elizabeth replied, not
rising to the bait.
"Was someone just talking about me?" A voice called out from
behind the doorway.
Elizabeth gave a squeal of delight and ran to hug the figure now
standing at the door, "Auntie Cathline! Hi"
Cathline responded to the hug, "Hi Lizzy, long time no see."
"You betcha. You look great! Come in."
Cathline gave a smile, "Thanks I always look great."
This was a running family 'in joke'. Now nearly fifty, Cathline could
still pass for less than thirty. When people asked her how she
did it she'd always reply with the comment "it's in the genes".
Cathline Richards alias Rachel Martin could still stun a room of
people with her grace and beauty.
Still grinning from ear to ear, Elizabeth beckoned Cathline to sit
down next to her son. Elizabeth sat down on the opposite
armchair. "Is mom and dad coming over?" Elizabeth asked
expectantly.
Cathline's perfect face dropped a little, "They couldn't make it
this week. Senator Jameson's asked them to help out with his
presidential campaign so they're all caught up in that. Kat, sorry.
Your mom asked if I wanted to run for Congress as well but I'm
not into that kinda thing."
The man sitting next to Cathline patted her leg in mock comfort,
"Ahhh how sad, you'll just have to put up with being a roving UN
Ambassador won't you."
"So that's how you pulled off the Starplane flight?" Elizabeth
stated. "That's an abuse of privilege isn't it?" Her quip hid over
the fact that she was bitterly disappointed that her parents
hadn't turned up to see her settle in, typical! At least Cathline
was here.
Cathline gave another devastating smile, "Hey not my idea. It
was Alex's. It's not my fault he talked me into it."
Alex gave an incredulous look "No Mom it wasn't was it?"
Elizabeth relaxed a little. Being with Cathline always had that
effect on her. Her son, Alex however had the opposite effect.
Somehow he knew what buttons to press to make her feel off
balance and awkward. It was a knack that usually only big brothers
have, but he seemed to have acquired it anyhow somewhere down the
line too. Elizabeth was saddened to hear that her mom and dad
couldn't make the trip and on that thought said, "I'd have thought
mom and dad could put aside just one trip to see me settle in."
Cathline gave a comforting smile, "They do love you Y'know.
When they said that they couldn't come I thought the same thing
as you. Kat as always knew what I was thinking and explained
that they trust you to do the right thing and that you have it all in
hand. Of course they'll visit next week just to be sure, but I
wouldn't worry about them not loving you. Kat cried herself to
sleep at the thought of her little girl moving away for so long.
They will miss you. Alex dear go and swipe the meter for me,
I'm not sure how much time I put on it."
"OK mom," Alex said, and left the room.
"Good! Now he's gone for a while, so I can say what I really want to
say." Cathline said in a secretive way.
"Which is?" Elizabeth offered.
"I hate keeping the truth about you from Alex, but it's the best
way. As far as he knows you're Kat's daughter not Dr Elizabeth
Bexley's. Some things are best left unsaid. Anyway the real
reason why they're not here is that they wanted you to stand up
on your own for a while. Sure they'll be there to catch you if and
when you fall, but they don't want to repeat the mistakes Dr
Bexley's parents made of wrapping her up in cotton wool."
"I know. We decided a few years ago that if we couldn't change
the genetic factors we can change the environment. I'm glad
you're here Cathline. I need someone to talk to."
Cathline placed her hand on Elizabeth's arm, "I know that's why
I came."
Elizabeth suddenly had a revelation but only raised a quizzical
eyebrow in response, "It's odd. I know, sorry I can feel why
you're doing what you're doing. You're playing the
counterbalance role aren't you. You're the soft edge to mom and
dad's hard one aren't you? They've asked you to look after me
in ways that they won't allow themselves to. You're my safety
net. My judge and jury. What happens if I start acting like HER?"
Cathline was inwardly shocked at Elizabeth's insight. She
scrabbled around for an answer and tried to think of a way of
averting more questions. Elizabeth would be able to spot a lie
instantly. Cathline nodded slowly and answered, "You're your
mother's daughter alright."
Elizabeth raised her voice a little, "Which Mother? Kat or my real
one?"
Cathline gave a smile, "That, kiddo, is entirely up to you."
Elizabeth was still rattled by her revelation. So much of her
childhood slotted into place now. Why hadn't she seen it earlier?
"It fits It all fits. The three of you, mom, dad and you decided as
soon as you knew about me how you were going to raise me
and what you were going to do in the event of me turning out
like the hell bitch."
Cathline could sense the anger starting to brew inside Elizabeth.
She needed to defuse it and fast, "You are quite correct. But I
don't see how it's any different from any other parenting. With
Alex I had a plan how I was going to raise him before he was
even born. I knew what I was going to say and do in certain
situations before they came up. Any good parent knows how
they want to bring up a child before they have one. Sure they
can change plan or tack as things evolve. Listen, who you are
has made no difference to the approach we used to bring
you up. I'm your God Mother right?"
Cathline's logic was starting to defuse Elizabeth's anger.
Elizabeth just nodded in response.
"Well, I take that role seriously. It's my responsibility as your
God Mother to ensure that you are being brought up in the
correct way. It's the same for John as it is for you. If I'm acting
as the counter balance as you call it, it's because we think a
counter balance is needed, not because your mother was Dr
Bexley. That's an important difference."
Cathline was right of course, "I hate it when you three gang up
on me," Elizabeth replied.
Now in full flow Cathline continued, "It's not us versus you. It's
not you versus anybody. It's how Kat and Matthew decided
to bring you up. I knew Elizabeth Bexley when she was a little older
than you and you are nothing like her. From where I'm sitting
Kat and Matthew have done a wonderful job of raising you.
You're a brilliant, witty and sensitive young woman. You're more
like Kat than HER and I should know. Listen, how many times
must you be told before you believe us. You are nothing like
your biological mother and never will be!"
"Then why all the subterfuge? Why make me take Olanzapine
until I was old enough to decide for myself?"
That was a question Cathline refused to answer.
Elizabeth however refused to let it drop. "I thought as much. You
DO think I'll turn out like HER."
Cathline made eye contact with Elizabeth and said, "No we
don't! Out of all the time you spent with Matthew and Kat did
you ever think for one second that they didn't love you?"
Elizabeth knew that Cathline was right, "No," she shook her
head gently.
Cathline continued, "That's a thought worth holding onto don't
you think? Look this is something you need to talk to Kat or
Matthew about. This goes beyond my...."
"Beyond What Mom?" Alex called out as he entered the room.
Cathline jumped ,"Alex, don't do that to me. How long have you
been lurking?"
Alex shrugged "I don't lurk. The Meter was all paid up anyway.
When do we eat?"
Cathline turned to Alex and said, "We don't. We've got to leave
now. We're taking a normal flight back, and I've got some
business to attend to in New London. Elizabeth, remember what
I said to you earlier. I'm sure you'll settle in just fine."
"But mom, we just got here," Alex complained.
"I know you want to wind up Elizabeth some more, but I think
she's got enough to do. Elizabeth, nice to see you again. Say
bye Alex."
Alex replied with a grin, "Bye Alex"
Elizabeth stood up and gave Cathline a hug, "Thanks Auntie
Cathline. Tell mom and dad they were right won't you?"
"Sure," Cathline said and returned Elizabeth's embrace. She
was relieved she'd managed to avoid a fight with her. Kat was
right. Elizabeth needed to be handled the way they'd planned it.
It was the only way.
-- o -- o -- o--
Angela Holden struggled with her bags as she strove to get to
her new room. The cab driver had dropped her off nearly a
kilometer too short and now as she clutched all her worldly
goods she really wished she had some knight in shining armor
to help her carry it all.
She could just see her destination when she saw a very tall,
stunningly beautiful woman walk out of there, followed by a tall
athletic young man. The man casually looked around him,
apparently taking in the serene, scholarly and timeless
atmosphere that Cambridge still generated after all these
centuries. Angela's heart skipped a beat as she saw him look at
her struggling with her bags. He tapped the tall woman on the
shoulder and whispered something to her. The woman turned
and her single good eye looked right at Angela and she nodded
her approval to the man. Angela eyes widened, Rachel Martin!
Before she could think any further she saw that the young man
was running towards her.
"Hi, I noticed you were having trouble with your bags? Mind if I
help?" the young man asked Angela.
Angela, now fully composed, took the opportunity to study her
potential rescuer. She would later describe him as tall, dark and
handsome . Gallant too if his offer for help was for real. Before
she could say anything he followed on, "I'm sorry my name is
Alex Richards and you are..."
"Angela Holden, " Angela blurted out. This is Rachel Martin's
son!!!
"Well Angela Holden, you have two choices. You can let me
carry your bags where you want to go, as long as it's not Oxford
or anything, or you can struggle with them yourself? "
"I'm sorry I wasn't expecting..." Angela blurted out. She'd seen
Alex's face in several magazines, but to meet him face to face
had taken her breath away. In her teenage years she'd had a
crush on him, and now to finally meet him was too much.
Alex gave another wide smile, "It's ok, I have this effect on
women all the time. Here let me take that for you," Alex offered
to take the largest two bags from Angela.
Much relieved Angela let the bags go and instantly felt better.
Her shoulders felt raw from the straps digging into them and to
have any kind of relief was a godsend. "My room's 22B, " she
managed to say. She noted a 'Oh no' kind of look flick across
Alex's face, but it was gone before she could be sure
what it really meant.
Alex hoisted the large bags onto his shoulders with an ease that
surprised Angela and started off towards the direction he had
come from. Angela went to show Alex where her room was, but
Alex seemed to already know. "It's just on the right," Angela
said.
Alex nodded and put the bags down onto the floor and knocked
loudly.
"Ok, Ok," A voice called out from the room and Angela heard
the sound of a key being turned in the lock. Angela then had her
second shock of the day. Standing in front of her was none
other than Elizabeth Stephens. Her hair was a little untidy and it
looked as though she had just woken up. That face with it's
tumbling mass of auburn hair and blue-gray eyes was
unmistakable.
Alex broke the silence "Before you say anything Kiddo, I'm here
helping your new roomie with her bags."
Angela saw those blue-gray eyes flick a curious look in her
direction as if saying 'I'm not sure about this,' but then the mouth
broke into a wide smile, "Hi I'm.."
"Elizabeth Stephens," Angela completed in a hushed overawed
tone.
"No hiding from this face is there?" Elizabeth grinned. "I'll take
your bags for you. Alex, in the best possible way, get lost!
Auntie Cathline is waiting for you"
"Okay, okay, I know when I'm not wanted," Alex tutted in such a
way that Angela knew she wasn't that upset about being
given his marching orders. Alex turned to Angela and said
"Angela it's been a pleasure meeting you. I don't envy you
having her for a roommate. If you ask me they should never
have let her out." With that last comment Alex gave a single
fingered salute and turned to leave.
Angela turned round and gave an appreciative glance at Alex's
ass, "Very nice," she commented.
"So'k, you can have him," Elizabeth retorted. "Now let me show
you around."
-- o --o -- o--
Anne Baxter sat on the plane staring out into a bright blue sky.
The view from an aircraft never ceased to amaze and stun her.
She loved to lose herself in the endless variations of cloud, land
and sky. To her, flying was the second most enjoyable way to
travel. By far and away she preferred diving. She had first done
it years ago and had never forgotten the feeling of absolute
freedom and oneness with nature. It was this feeling that had
driven her to study marine zoology and biology. Her career in
medicine had been cut short by the love of the ocean and it was
one she never intended to follow up again.
She had enjoyed her time at Haverford, but now it was time to
move on. Since the death of her parents when she was younger
she had, had no real home, and no roots to put down, and that,
she decided, was just the way she liked it.
Her transfer to England had fallen thru at the last moment,
something to do with her visa she was told, but she had been
given an alternative placement in Tel-Aviv for six months before
having to return to Haverford. Looking on the bright side Tel-
Aviv was a whole lot warmer than Portsmouth and the Red Sea
was more inviting than either the North Atlantic or Anglo-French
Channel.
Tel-Aviv had been repopulated for over ten years, the deadly
agent spread by the Guild had been neutralized, the remains of
the people cleared away, and much of the infrastructure rebuilt.
Tel-Aviv was now one of the most modern cities in the world, the
chance to improve had not been missed but still, so it was said,
the aura of death hung over the city. Elizabeth had used her
PDA to brush up on the new Amex-Rough guide entries on it,
and the thought of living in a place where over half a million
people had been slaughtered was enough to make her stomach
churn. How could she walk down those streets knowing that in
every house and every office block people's lives had been
snuffed out?
She shut out anymore thoughts and reflected back on what she
really wanted to do. Go diving, study marine life, and finish her
dissertation.
The plane was starting it's descent and she would be in Tel-Aviv
in just over twenty minutes.
-- o -- o -- o--
"Ok then, Heels or flats?" Angela grinned.
"Flats, anytime," Elizabeth replied.
"Same here. We're about the same height and heels make me
look far too tall," Angela retorted. They'd been playing the
'answer right away' game for a while now.
"My turn. Skirt Pants or Skirts, " Elizabeth asked, casting a quick
glance to the black Skirt-Pant she was wearing.
"It's pretty obvious what you prefer, "Angela grinned.
"It might not be. I might hate this, but it's the only thing that was
clean. Anyway you're supposed to answer without thinking. That
is the purpose of the game is it not?"
"Ok then, Call me old fashioned, skirt."
"My turn again, Beckham-Kline or Armani?," Elizabeth queried.
"Oh yes old bean, Beckham-Kline! I never buy less than five at a
time," Angela joked, putting on a false English upper class
accent.
Elizabeth felt embarrassed. Much to her amazement she was
getting on extremely well with Angela, and had forgotten that not
everyone could afford the designer outfits she wore. "I'm sorry. I
didn't think," she muttered.
"It doesn't matter. My Mum and Dad had to save for fifteen
years to send me here, and the fact that I'm -- how'd you call it --
roomies with the famous Elizabeth Stephens, and at the best
university in the world is more than enough," Angela said, piling
on Elizabeth's guilt.
"This is a stupid game," Elizabeth commented.
"Ok my turn then. Money or power?" Angela asked.
"Power, anytime."
"Money," Angela smiled back.
"Can I ask you a favor?" Elizabeth asked.
"Depends. We've only known each other an hour," Angela
retorted.
"Forget who I am."
"Huh?"
"You've mentioned me three times as though I'm some
superstar. I came here to be me. Not some media image, or
some fixation of that perverse Bexley cult, but to discover who I
am and where I fit in. Please let me be just plain ol Elizabeth
Cathline Stephens."
Angela ought to have been upset, but Elizabeth had been right,
she had been looking at her as though she was some royal
princess. "Ok, Lizzy. I'm sorry, it's just that I've never even seen
anyone remotely famous let alone live with them. My Dad used
to be a computer programmer, before it all became automated
and he was laid off. And Mom worked as a secretary for Sony-
Micro-Sun-Paq. We never even went on holiday, sorry "vacation,"
as they put every Euro they had into giving me a better chance
than they had."
"It must have been hard. They must really love you," Elizabeth
said softly.
Angela thought she detected a note of jealousy in Elizabeth's
voice, "I just hope I live up to their expectations."
"I'm sure you will. If you put your mind to it you can do anything.
It's not been a picnic for me either. Yes Mom and Dad never
had to save to get me anything but I've always been in the
public eye. I've had more DNA tests than I can remember,
psychological screenings, IQ tests. And those photo's on the
front of the Enquirer last year were the worst ever. I have had no
privacy, and when people look at me they don't think oh look
that's Elizabeth Stephens they see HER, Dr Elizabeth Anne
Bexley. That horrid Bexley cult is the worst of the lot. Until tests
proved otherwise they thought I was the Second Coming or
something. That's the hardest thing of all. I can cope with blurry
topless photo's of me on my mom and dad's island but any
reference to the hell bitch just gets me right here, " Elizabeth
pointed to her heart.
"I'm sorry. Look if it's any help I don't believe any of those
rumors. I was just a little star struck that's all," Angela said, now
it was her turn to feel guilty.
"Hey I'm star struck too. It's not everyday I get to share a room
with Dr Angela Holden the greatest neurologist the world has
ever seen," Elizabeth grinned. The tension had been broken
and each of them had shown an exposed side of them. The
bond of acquaintance had grown into the glimmer of trust.
-- o -- o -- o--
Wills caught up with Mark in the canteen. He'd been worried
about him for a few days. Mark had been sullen, almost silent,
and to make matters worse had skipped several tutorials. At this
rate Mark was on collision course to fail his doctorate. Wills had
tried to talk to him several times but each and every time he had
gotten the cold shoulder treatment. It didn't take the length of
time they had been friends to work out that something was very
wrong with the normally upbeat Mark.
"Hey bud," Wills said cheerfully.
"Huh," Mark replied in a sullen tone.
Wills gave Mark an ultimatum "Ok. Look, you can ignore me or
grouch at me all you like but I'm not going away 'til you talk to
me."
"Ok fine, but there's no point. You can't help me, you'll just have
to put up with me," Mark replied.
"Since when have I ever put up with you?" Will asked with a
comforting smile on his face,
Mark managed a shrug back "Since now."
Wills indicated to Mark that they should take a seat at an empty
table at the far end of the canteen. Mark grudgingly agreed and
sat down opposite Wills.
Mark, admitting defeat and feeling as though he had to tell
someone, fiddled with his chicken salad for a while before giving
Wills a lost puppy dog look. "I went to find her."
"Who?" Wills asked.
"The woman I saw going into the faculty the other week."
"You never told me?" Wills asked.
"As soon as I saw her I couldn't get her out of my mind.
Something just clicked inside me and I knew that she was the
one."
"How can you know that? Anyway let me guess, she blew you
out," Wills said. He was tempted to make some kind of quip but
by the look on Mark's face this was no joking matter.
"Worse. Her neighbor told me that she's gone to Tel-Aviv. Now
I'll never see her again. If she'd blown me out as least I'd have
known where I stood, but now I'll never know. I was so sure she
was the one. Now I can't concentrate on anything and my
grades are slipping. That makes me more depressed and
makes me think more about losing her. I'm in a vicious circle,"
Mark now looked thoroughly down.
Wills, all thoughts of quips now quashed, said, "Did you get a
name. She can't have gone to Tel-Aviv forever, she has to come
back here to finish her course."
"I thought of that but her neighbor told me she was going to
England for two years but that got cancelled and so she went to
Tel-Aviv instead. Two Years, that's a long time. She'd find
someone else in that time. I may as well face it, I blew it, the one
woman I ever wanted and I've blown it."
Wills had an idea. "Look what's her name, we can look her up on
the net's white pages. Find out all about her and then we'll know
more. As for your grades, if you're not here in two years how can
you meet her when she gets back?"
Mark gave a smile. Hope had been restored and Wills was right. He
would work harder now. He had to be here when she came
back. "Her neighbor gave me her name, Anne Baxter."
-- o -- o -- o--
Anne eventually emerged from the Tel Aviv arrivals lounge and
was hit by the dry heat of the midday sun. After waiting in line
for her baggage she headed for the local Avis rental desk. It
was a fair drive to her lodgings and already she was tired from
the long flight over. After queuing for about ten minutes she
reached the desk.
"Passport please," the Avis lady asked.
Anne noted how all service desk, Hostesses and receptionists
all seemed to look the same the world over. Maybe it was their
impossibly sunny disposition that caused made her think that.
Anyway she handed over her passport to the lady.
The lady studied it for a few moments before returning it,
"Driving permits please."
"Will this work? It's got all the options I want?" Elizabeth fished
out her PDA and showed it to the lady.
"Sure, just aim it at the terminal, its called Avis4526"
Anne was relieved, the last thing she wanted to do was fill out
masses of forms. She pointed the PDA at the lady's terminal,
"PDA, transmit my driving permit and hirecar details to terminal
Avis4526."
The lady gave a smile, "Thank you Ms Baxter. You car is in lot
24. It's the blue GMFord starlight. It's been serviced last week
and there's a spare fuel cell in the trunk if you need it. I've
transmitted your biometric profile to the car so all you need to do
is grab the handle. I've also sent an online map of how to get to
the car so just consult your PDA. Enjoy you stay, thank you for
using Avis."
Anne gave a nod of thanks and wheeled her luggage cart
outside into the blazing heat of the day. On her way out she
noted the small plaque on the wall commemorating the twenty
three thousand men, women and children that had died at this
airport over twenty years ago. Anne had seen this in the
guidebook. In every building and street there were memorials to
the dead, but seeing it here on a wall really brought home the
atrocity that had been committed in this now thriving city. She
hoped she would be able to remove the morbidity of this place
from her mind but then again did she want to? Would doing that
deprive her of her compassion? Only time would tell.
Anne consulted her PDA and a flashing arrow told her that the
Avis depot was two hundred meters to the left. A few minutes
later she was standing next to a Blue Gmford. It had been newly
washed and sat there gleaming in the sunlight. Anne grabbed
the handle of the car and the door sprung open. Miniature
sensors on the car handle had read her hand and fingerprints.
Cross checked them with its database and had decided that she
was who said she said she was. Anne reached inside the car
and pressed the trunk release and moved around to the rear of
the car and loaded her luggage into the trunk. After dutifully
sliding the cart back into the cart retrieval area she got inside
the car and closed the door.
Within a few seconds the cars climate control had kicked in
filling the car with warm, cool air. Anne had one last thing to do
before she was ready to leave, she pointed her PDA at the car
entertainment system. "PDA, download all music tracks to
Gmford regno A56433X. Also program GeoNav system with our
destination and work out the quickest route avoiding all current
congestion," the PDA confirmed its acknowledgement.
Anne felt her seat reshape it's self to give a perfect fit, and after
settling herself down. She pressed the start button on the
console and felt the smooth hum of the engine. "Car engage
autoNav and let me know when we're five minutes away.
"Yes Ms Baxter," the car replied in a smooth silky female voice.
Anne gave a smile, Rachel Martin would do anything for money
these days. Anne felt the car move off and onto the freeway.
Anne's own car was nowhere near this advanced and anyway
she preferred to drive herself. Anyway was there any other way
to drive a late 2000 model year Porsche?
"Car, dim the windows and play track 4, no video, audio only."
Anne sat back into her chair, closed her eyes and started to
listen. This was just the song that matched how she felt at the
moment.
"I stood close enough to hear you say
'Do as the beautiful ones do'
Tore out my picture from its frame
I just wanted to be one of you
Standing on the outside
Lookin'
Lookin'
Funny how you see the truth
But the feeling does come back
To you
She's crazy as anyone can be
That's what they say
They say of me
Wanting love can make one do
Isn't my fault
Heredity
Standing on the outside
Lookin'
Lookin'
State of grace
State of sin
Standing on the outside
Lookin'
Lookin'
I cannot feel a single thing
But the feeling does come back
Again
This morning feels like yesterday
Yesterday follows me around
Where do you go where no one cares
Six feet under
Underground
Standing on the outside
Lookin'
Lookin'
State of grace
State of sin
Standing on the outside
Lookin'
Lookin'
I cannot feel a single thing
But the feeling will come back
Again - again"
-- o -- o -- o--
"So your parents worked for fifteen years to send you here?"
Elizabeth asked. It was now nearly eleven pm and they had
been talking for hours. Elizabeth felt relieved things were going
so well. Later on in the week when she called Kat she would
describe Angela as 'normal'. But for now Elizabeth was just glad
to have someone her own age who she could just be herself
with. Of course it was early days but, judging by the signs it was
going very well. Her only point of reference for this kind of
friendship was the sisterly bond between her mom and Auntie
Cathline. Although her friendship with Angela was a long way
from being that close it did have a positive beginning and that
Elizabeth decided was more than she'd hoped for.
"Yeah. I determined to work my hardest so that their sacrifice
wasn't wasted. I've borrowed a PDA, brought the cheapest e-
books I could find and promised I'd pay them back every Euro
they gave me."
"I've had to pay for myself to be here. Sure mom and dad give
me an allowance but my tuition fees and everything else comes
from my own money." Elizabeth stated.
"Gave you a million to play with did they?" Angela said with no
hint of sarcasm or malice.
"I wish. They looked at what the average student needs and
gave me that amount. They made it damn clear that if I needed
anymore then I'd have to work for it."
"Whoa that's tough!" Angela said. She was surprised. She had
expected the famous Elizabeth Stephens to be on a sum fit for a
princess.
"You don't know the half of it. Sure I've got my Beckham-Kline
outfits and Armani skirt-pants but I had these before I became
a student here. My mom and dad are adamant. They had to
make it by themselves so I have to. "
"That's a tough lesson, but fair I guess. Tell me are they like
they are portrayed in the past. Did the things they say happen
really happen?" Angela asked.
"If you mean do I believe what they tell me or what other people
have said, I believe mom and dad every time. It's no accident
who I look like. I saw photos of dad and Mom when they were
transformed. I've seen Auntie Cathline's ruined eye and I've
seen more evidence of Dr Bexley's evil than I care to think of.
Sure she redeemed herself to the world at the end but not
before causing a lot of people a lot of pain"
"You sound bitter against her. She's been dead for twenty years
and I was always told she emerged a heroine. Her final act of
stopping a war was seen as a triumph and her tragic suicide just
added to the mythos," Angela said.
Elizabeth shrugged, "Sure that's the way the history books tell it
but what people don't get is that it should never have happened
in the first place. Even Mom and Dad have a rose tinted view of
her now, they say that she strengthened their relationship
beyond what it would have ever become and that probably the
destruction of Tel-Aviv and Cairo would have happened at some
point in time anyway."
"They are probably correct. At the time it was seen as a great
horror but sooner or later somebody was going to use a genetic
weapon and nuclear ones too. That's the benefit of hindsight. We
know the socio-economics of the time and can work backwards
from there. A Middle East conflict was inevitable. If the Guild
didn't do it, Iraq would, if Iraq wouldn't then somebody else
would. As soon as somebody found a way to create a genetic
weapon then it's going to get used. Dr Bexley just happened to
be in the wrong place at the wrong time. In some ways she was
there are the right time, your parents too", Angela stated.
"That maybe and that's what the history books teach but I still
hate her for what she put Mom, Dad and Cathline thru. Mom
used to call her 'hell bitch' and that name suits her just fine,"
Elizabeth was showing real emotion now. In some ways she
wanted to tell Angela the truth about her relationship to Dr
Bexley but that was one secret she was determined to keep.
"Remind me never to cross you," Angela said with a smile.
Elizabeth grinned back, "Hey no problem. I'm beat and we've
got a big day tomorrow. See you in the refectory at midday?"
Angela nodded her agreement. Like Elizabeth she was pleased
with the way things had started off.
-- o -- o -- o--
The first week or so of Elizabeth's course went surprisingly
quickly. Cambridge was a fascinating city with so much history
that Elizabeth couldn't help but fall in love with the place. It was
so wonderfully quirky and full of tradition, most of which people
hadn't a clue where they came from but performed anyway.
There were innumerable book shops, still selling paper bound
copies and little markets tucked quietly away in the corner of
some ancient cobbled street. She had spent a number of free
periods in the museums and still admitted she hadn't even
scratched the surface. She and Angela had enjoyed a quiet
picnic by "the backs" a secluded stretch of green straddled by
the clear, slow moving river Cam and had booked next week to
go for a punting trip down the river. At the moment her studies
were lightweight but she knew as the weeks drew on the the
pace would rapidly ramp up. For the moment she lapped up
every second of the olde worlde atmosphere of the ancient city.
She was now spread out on the sofa, she had put away her
Beckham-Klines for special occasions and had splashed out on
the de-facto student attire of denim jeans and baggy sweater.
Her new hairstyle still felt strange and she missed her long
flowing locks, but the shorter style was more practical and
attracted less attention. Angela had wanted her to go blonde but
this was too radical a move for her at the moment. It did give her
a rather 'girl next door' look but she didn't mind. She wanted to
move away from the old Elizabeth and find her own way. She
was a little sad that her parents hadn't yet had time to visit but
she suspected that this was their plan all along. This suited her
just fine at the moment, she was relishing her independence
although she was glad that at least Angela shared her
neurology class. She gave a yawn and reflected on her
relationship with Angela. For two people of such disparate
backgrounds they shared a lot of common views. Angela had
soon lost her starstruck awe of her and that Elizabeth thought
was a welcome change. Angela treated her for who she was not
where she came from.
Elizabeth had had childhood friends. Alex was one of her
closest in spite of all his teasing but Angela was rapidly
becoming one of her 'inner circle'. Of course she had told no
one about her real origins, that would ruin everything. It shouldn't
have made much difference to her who her mother was but in
the back of her mind she couldn't help but worry if she was
destined to turn out like her. What worried her most was that by
all account the hell bitch's parents hadn't been much different
from her own. If they had been powerless to stop what
happened to Elizabeth then surely hers would be too. Elizabeth
knew that she couldn't help but be hurt somewhere along the
line she just wondered how far that hurt would need to run.
At the age of eighteen her parents had given her the
responsibility for choosing whether to take the Olanzapine or
not. Initially she had chosen not to but as it dawned on her that
environment or not she had the same mental flaw that caused
the Hell bitch to wreak so much havoc she owed it to herself and
any future partner not to take that risk. So, everyday she
dutifully took her Olanzapine, it would be foolish not to. Angela
had asked what it was and Elizabeth had told her it was her
Asthma medicine. It was even specially stamped with the wrong
label so that a casual glance couldn't give it away.
Elizabeth's train of thought was interrupted by a loud knock on
the door. Wearily she got up and answered the door. On seeing
who it was she gave a whoop of joy and embraced the couple at
the door. "MOM, DAD you came!"
"Hi little mite," Matthew said with a smile. It had been too long
since he'd seen his number one daughter.
"I like the hair. It makes you look a little stern but a lot more
mature," Kat commented.
"How, how?" Elizabeth started. She never expected to see them
this early on. She'd been told they'd visit in a month or so.
Matthew gave a smile "We took a detour on our way over to
Manhattan. We thought we'd drop in and see how you were
doing."
"Please come in, it's a little bit of a mess. Where's little bro?"
"Thanks. John's at Yale. He couldn't make it over but I'm sure
you'll see him at the end of the semester," Kat gave Elizabeth's
apartment the once over. The little bit of mess Elizabeth was
referring to was two unwashed coffee cups on table.
"Nice place. How's the roomie working out?" Matthew asked,
taking a seat on the sofa.
"Angela? She's great. When I first heard I was getting a
roommate I was afraid that I'd get some prissy English girl but
Angela's not like that at all. She should be back soon, I'm sure
you'll like her," Elizabeth looked guiltily at the coffee cups and
discretely put them into the kitchen area.
"It's ok Liz. You are allowed to be messy sometimes. I thought it
was traditional for a student," Kat said.
"That's what Angela says. You should see her room. It's a tip.
She does clear away the meal things though which is the main
thing."
"That's my girl. Never a thing out of place," Matthew grinned.
"How's the course going. Not too much hard work is it?" Kat
asked.
"Is anything ever hard work for me? Not really, they're still in
ramp up mode at the moment so I'll have a better idea in a
month's time. Cambridge is wonderful, so much history, and the
quality of the research is nothing like we have back home,"
Elizabeth enthused.
Kat put on her serious mother-daughter chat face, "Cathline told
me you were feeling a little abandoned when you first got here.
You seemed to be building up to a fight with her when Alex
walked in. Are you ok now?"
"I guess so Mom. I wish you didn't live either side of a continent
or ocean, there's so much I want to tell and show you, but I can't
because you're over there and usually too busy to leave,"
Elizabeth said sadly. As always her mom had gotten right to the
heart of how she felt. Sometimes it was infuriating but other
times like now it was a welcome relief. Cathline had told her she
felt exactly the same way about Kat sometimes. It was one of
her mother's defining character traits.
"It works both ways Elizabeth. We need to give you enough
slack and freedom to find out who you are but be there if and
when you fall. It's a delicate balance and it's one we'll admit we
haven't got right yet. Not with you and not with John. All we can
do is hope we've given you enough to know what's right and
wrong and to use compassion, wisdom and courage that we
know is in you. It looks to us that you're doing just fine. We have
our own lives to live just as you have yours. But the thing is,
the real thing to hold onto is that we are there for you, and if we
should ever need it you are there for us. That's what family is all
about," Kat said in her most reassuring voice.
Elizabeth felt relieved at this. Kat had a way of sorting things out
in just the right way. "Mom I'm worried about me. I feel like a
time-bomb about to go off. I'm so scared to get into any kind of
deep friendship with anyone, just in case they hurt me and I go
and strike back. When the hell bitch struck back, people died."
"Are you talking about this Angela?" Matthew asked.
"I guess so. She's tried to fix me up with a date a couple of
times but I've turned them all down. Is it right for me to feel like
this?"
Kat placed a hand on Elizabeth's leg to reassure her. "You can't
keep holding people at arms length. You'll end up a very lonely
and shallow person otherwise. What's the point in being able to
feel, talk and love if you can't share them with anyone? You may
as well be a robot, devoid of any emotions or the qualities that
determine our humanity, Take Alex for example. Do you know
why he treats you like a kid sister?"
"Because he hates me? Thinks I'm a pain in the ass?" Elizabeth
answered.
Kat gave Elizabeth a smile, "Alex doesn't hate you. He may
think you're a pain in the ass sometimes and he'd be right. He
asked me a while back how to reach out to you. He doesn't
understand you. His teasing is his defense mechanism. He
wants to be closer to you, to really get to know who the real
Elizabeth Cathline Stephens is, but you've spent all your life
pushing him away."
"He never told me any of this," Elizabeth stated. What was mom
driving at?
"He wouldn't. He cares too much about you to put pressure on
you like that. He wants to be your friend, but on your terms."
"You mean he's got the hots for me?" Elizabeth said. Surely
not!
"I don't think so. You two grew up together and in some respects
treat each other like brothers and sisters so of course there's
going to be a bit of good natured needling. But in any good
friendship there should be a serious sharing of thoughts and
feelings. I'm not telling you what to do but If I were you next time
Alex visits take him out to dinner. Wow him with how much of a
wonderful young woman you've become."
Elizabeth had a mental image of her sitting down at a restaurant
table with Alex and sharing a candlelit dinner. The image made
her smile. What a ridiculous thought!
Kat saw what her daughter was thinking and commented "All i'm
saying is open up to people. This Angela sounds fun, start
sharing with her, do something impulsive for a change. Sure you
can have picnics by the river and that's an important part of a
friendship but you need to move on. Do you know how you
prevent becoming the reincarnation of the hell bitch?"
"Kill myself?" Elizabeth said cynically.
Kat gave a concerned look at Matthew, "If you tried that I
WOULD be worried. No, you start by sharing with those you
trust. Then when the hurt comes you are prepared for it, it will
hurt but you will have the friends around you to help you out.
Notice that Dr Bexley had no real friends before she met
Cathline and Matthew. When the hurt came she reacted like a
spoilt child. Before Matthew jilted her she'd never been
wounded before. For a woman of her obvious intelligence she
was very naive. Lizzy, put down your roots of trust in those you
love and care for. Us, Auntie Cathline or anybody you feel you
can lean on when the tough times come."
Now it was Matthew's turn to say something, "Your moms right.
Start to live a little. Learn to trust more, learn to love more and
learn that from the pain you emerge stronger and a better
person than you were before."
Elizabeth thought for a few moments, "So you're saying that we
need pain, hurt and conflict in our lives in order to grow. If that's
the case why do people who are always getting hurt are in such
a mess?"
Kat gave a smile. Elizabeth had nearly got it, "It's a question of
balance. The trick is, to work out the balance for yourself. And
nobody, not even us can tell you where that is."
"I need to work this out for myself right?" Elizabeth questioned.
"Fraid so little mite," Matthew quipped.
Elizabeth sat in silence for a minute or so. Her parents were
right. She had to take the next step but why was she so afraid
to?
Again Kat read her thoughts, "Scary isn't it? Let me tell you
something. When I knew your dad had been turned into Dr
Bexley it'd scared me so much I didn't know what to do. Sure I
was as mad as hell and sure I was concerned for his safety but
one thought I remember going around and around in my mind
was 'Yes I love him but can I go thru with this?' I spent the days
leading up to Xmas in my old house in mourning for what I'd
lost. Although I might learn to love again I knew deep down it
wouldn't be the same. I don't know how to describe how
Matthew and I feel about each other but the only term I know
that fits is 'soul mate' I feel as though Matthew and I have waited
throughout all eternity to meet each other. It was that depth of
feeling that drove me to stand by him no matter what. But to
reach that stage I had to take it one step at time and do
whatever it took to get there."
"I guess so mom. I'll try." Elizabeth said softly.
"That's my girl. Kat I think it's time we were going," Matthew said
with smile.
Angela walking in interrupted the conversation. On seeing
Matthew and Kat she almost took a step backwards in surprise.
Kat cast her eyes over Elizabeth's roommate. She was nearly
as tall as Elizabeth was and had a similar shaped face. Her hair
was raven black and a pair of intelligent looking green eyes
looked back at her. It took a few moments for Angela to register
and then she held out her hand, "Hi, you must be Elizabeth's
parents?"
"This is Matthew and I'm Jane," Kat replied returning Angela's
handshake.
"Elizabeth been dishing the dirt on me has she? How I never
tidy up, always leave my clothes in a heap on the floor, and
convince her to have her hair chopped short," Angela said with
a warm smile.
"If you can convince Elizabeth to do anything she doesn't want
to do then you're better than we are," Matthew joked.
"Dad," Elizabeth complained as though she was still fifteen.
"Elizabeth, we're in New London for another day. I'm told there's
a direct train into Kings Cross. Should only take an hour. We're
staying in the penthouse of the Langam Hilton. We'd love it if
you'd join us for dinner tomorrow. Angela can come too if she
wants," Kat offered.
"Thanks mom I'll come. Angela you want to meet the 'olds'?"
Elizabeth asked.
"I think I'll pass. It's about time I did some work," Angela
commented.
"But Angela, this is the Langam Hilton. Think about it -- world class
food, health spa's, rejuv-sauna's everything. It'll be great,"
Elizabeth pleaded.
"You've got the brains to cruise all year, I'm afraid I haven't. Mr
and Mrs Stephens thank you so much for the offer and if it were
last week then I'd be there already."
"We understand. Maybe next time," Matthew concluded.
"Elizabeth, we've transferred a little bit extra into your account
for you to buy something nice for the meal. See ya tomorrow
about eight?, " Kat smiled at Elizabeth and gave her a hug.
"Bye mom, Bye dad," Elizabeth said and gave Matthew another
rib bursting hug.
"Maybe we'll get chance to get to know you better next time.
Nice meeting you Angela," Kat gave Angela a goodbye wave,
Angela just smiled in return.
Elizabeth followed Matthew and Kat down the stairs and waved
to them as they drew off in their hire car. She slowly walked up
the steps and found Angela eating the last remaining null-fat
chocolate bar.
"You could've been a little bit more civil to them?" Elizabeth
complained.
"What?" Angela stated.
"They offered to treat you to a thousand Euro meal and you turn
them down. Work my ass. You're assignments don't start until
next week," Elizabeth sniped.
"I'd rather have had the money. Besides, you need to spend
some time with them without me getting in the way. Tell me on a
scale of one to ten, how anarchic are you feeling? Want to do
something REALLY impulsive and downright stupid?"
"Why?" Elizabeth said suspiciously.
"Look at this. I thought we might go," Angela held up her PDA
and showed Elizabeth the screen.
"WHAT! Have you lost your stupid limey brain?" Elizabeth
almost shouted.
"It'd make the meeting interesting for them. Wouldn't it?" Angela
said with a mischievous glint in her eye. "Besides, we start work
proper next week, we won't get much chance for living on the
edge for a while AND so the flyer says they have a special visit
by the chief priest or whatever he's called," Angela's green eyes
were gleaming with mischief and devil may care.
"It'd make me dead that's what it would. You seriously expect
me to walk into a Children of Bexley rally?" Elizabeth was
incredulous. This idea was madness. Every fiber of her being
hated the thought of going and yet a small part of her reveled in
the sheer devilment of it.
"I've got this coat you can wear, it's got one of those hoods. I
thought we'd wait until they were in full flow. You would stand up
to leave and accidentally let your hood drop. Imagine the look
on their faces when they saw it was Dr Bexley's look alike in
among them."
Elizabeth's mischievous part was now starting to assert itself,
"But they hate mom and dad. They say it was their fault, that the
whole thing was some con trick to get their hands on the hell
bitches money. They would kill me or at least hold me hostage."
"Don't be stupid -- they haven't tried yet have they? They're justa
harmless bunch of wacko's. Let's find out what they really think
about you. I'll set my PDA on instant alarm, and you can do the
same. Come on, you know you want to. You can get them back
for all the grief they gave you over your blood tests, mental
profile, and every other test they forced you to have just to
disprove them."
"Instant alarm huh. Payback's a bitch isn't it?"
"In this case, a hell bitch," Angela said with a smile.
What the hell Elizabeth thought and gave Angela a confirmatory
smile.
Angela gave Elizabeth her spare coat and Elizabeth placed the
hood over her head. It covered up most of her head and left only
her blue-gray eyes showing.
"PDA set to instant alarm. Call emergency 211 in the event of
my heart stopping or the next keypress," Angela said.
Elizabeth repeated the command. From a position of fear she
was now basking in the thrill of the forbidden and downright
dangerous. She had never done anything like this before.
Normally she was so logical and precise but this was more
impulsive than she had ever been in her life. The tingling
sensation of fear was an addictive one. Her parents had warned
her against having anything to do with the Children of Bexley
cult. Elizabeth knew that her life as she knew it would be over if
they found out whom she was really descended from. That's
what made this all the more thrilling.
They took the autobus to a small city called Ely, some fifteen
miles from Cambridge. It was far enough away not to let the cult
members know where they came from but close enough for a
quick getaway if required. Elizabeth and Angela were silent
during the twenty minute trip. Soon they were outside of an old
car dealership in the middle of town. It had been converted into
a meeting place and people were streaming in. Elizabeth could
hardly keep herself from running back to the bus station. The
butterflies in her stomach were multiplying with every step and it
was all she could do to keep down a scream. Angela clutched
hold of her arm and Elizabeth felt reassured that she was there.
As she approached the door she held her head down and took
the paper flyer a well dressed man at the door passed to her.
Her head still down she took a seat at the back and as far away
from the 'congregation' as she could. By now there were about
two or three hundred people of all walks of life. They were sitting
down quietly waiting for the meeting to start.
"I want to leave," Elizabeth whispered to Angela.
"Shh it's starting," Angela said and gave Elizabeth's arm a
squeeze. Elizabeth's nerves were catching.
One by one the people rose and clapped as a man dressed in a
smart Armani suit walked onto the stage. His goatee beard was
newly clipped and his blue-gray eyes surveyed the sea of
people in front of him. Just looking at him Elizabeth could feel
the charisma of the man. She knew that just by listening to his
voice those of weaker will would believe anything he told them.
There was something supernatural about his demeanor, and
caught up in the rising tide of cheering and clapping, Elizabeth
felt herself joining in. She cast a glance at Angela. She too had
been unable to resist the groundswell of emotion pouring out
into the room.
The man beckoned for them to sit and Elizabeth did so. She
saw the man glance again across the room and she hurriedly
avoided his gaze. The last thing she wanted to do was reveal
herself. She decided she would sit tight and listen and then
leave. It had been a grave mistake to come here.
Elizabeth felt Angela's grip tighten on her arm once more. The
man had started to speak.
"Thank you all for coming. It's been a long trip for me and I know
it has for many of you. For those new here let me introduce
myself. My name is James Adams and I am currently the one
honored to be called the leader of the Children of Bexley. From
when I was young and my mother showed me the results of the
second Bexley trial I knew that this woman had something to
teach us."
"Yeah how to kill people," Elizabeth whispered.
"Shh this is fun," Angela said.
"Her life was an extraordinary testament of triumph over
adversity. We all know the records of the Fury have been
tampered with in order to protect those who robbed Dr Bexley of
her inheritance. For those who are unsure let me put forward a
few facts.
Firstly, If this DNA machine ever existed where is it now? Once
invented things do not un-invent themselves.
Secondly the altering of a person at the genetic level goes
against all known laws of molecular biology. For those that are
interested you can pull down a detailed e-book on it.
Thirdly. It's interesting that those who were so called affected by
the Fury all received multi million dollar payouts without having to
go thru the courts to get it!.
Fourthly, There are no records and biopsies of the so-called
changelings. We have no one's say so that they ever existed.
Fifthly the agent used to destroy Tel-Aviv was not a genetic
warhead but a highly corrosive acid, condensed into a fine mist."
The man paused to let his facts sink in. "He's right about the
DNA bit," Elizabeth stated, "Nobody's ever worked out how Dr
Bexley managed it."
"Then there's the sixth fact. The use of prosthetics and cosmetic
surgery was nearly as advanced as it is now. The only way a
double of Dr Bexley could be created was by use of those
methods."
"Angela I want to go now," Elizabeth stated.
"Not yet, I'll give you the nudge," Angela whispered back.
"Anyway I hope I have given you enough to think about. There
are about another twenty or so facts but I won't bore you with
them Use your PDA's to get to http://www.come.to/children-of-
bexley and read all the evidence for yourself.
You've seen the pictures of Matthew and Jane Stephens on the
campaign trail with senator Jameson. What a fine upright couple
they make. So would you if you had used the deviousness of
the devil to rob an innocent woman and kill her parents on their
way to a mercy mission."
Anger grew inside Elizabeth and she could take no more. It had
been a mistake to come here. Not for her safety, but this whole
charade was a gross insult to the memories of those who had
been killed. She felt Angela pull her down but she shrugged off
her arm.
"THAT'S A LIE!" Elizabeth roared and flung her hood back. Her
face was red with fury and her blue-gray eyes had a murderous
glint in them.
The man on the platform looked shocked for a moment and
Elizabeth felt every eye in the room turn and face her. Those
eyes widened and gasps of shock echoed around the room. The
man had already composed himself and said in his most
persuasive voice, "Tell me your name child"
"My name is Elizabeth Cathline Stephens and what you just said
was a perversion of the truth and an insult to everyone who died
trying to stop your precious Dr Bexley," Elizabeth's voice was a
quiet menacing hiss.
Angela looked up at Elizabeth. She had seen pictures of Dr
Bexley and now Elizabeth looked as murderous and as deadly
as her late namesake ever did. She felt a cold shiver run down
her spine. What had she done?
The man said in his most placating voice, "Ladies and
gentlemen we are greatly honored tonight. The daughter of our
revered mother is here amongst us. Please join me in showing
your true feelings."
Elizabeth put her hand into her pocket, ready to trigger the PDA,
but saw to her amazement that the man on the platform had got
down on bended knee. One by one everyone in the room save
Angela was kneeling in front of her. Elizabeth could hear the
whisperings of "Blessed mother thank you" and "Welcome
daughter of the most high mother". The chants of praise to
Elizabeth grew louder and louder and Elizabeth felt her soul rise
with the sound of her praise. It was a feeling like none she had
ever encountered. Elizabeth found her arms outstretched as if
accepting all the praise that was being directed at her. It was an
intoxicating feeling and one that Elizabeth never wanted to end.
Before things go too much out of hand Angela stood up and
dragged a mesmerized Elizabeth out of the room and onto the
street. Away from the chanting Elizabeth's head cleared, "What
the fuck was that," she swore.
"You tell me? They were worshipping you!" Angela exclaimed
"Cool wasn't it! Promise me one thing," Elizabeth asked
"What's that?"
"I don't EVER want to go back there again, " Elizabeth muttered.
The feeling of anger had left her elated and the praise as though
she were some goddess had left a hook in her that she found
she didn't want to remove.
Elizabeth was sullen on the bus back to Cambridge. She didn't
want to explore the feelings that the meeting had awakened in
her. The feelings of power, of being an unstoppable force of
destiny and of hurt simmered inside her. How dare they call her
parent's murderers and thieves?
"Elizabeth I'm sorry. I thought it'd be a laugh. I don't know what
to say," The image of Elizabeth in full fury was imbedded in her mind.
"You don't have to say anything. How can they believe such
things? You've met mom and dad did they seem like they had
arranged the murder of someone's parents just to steal some
money? I don't get it, they've never done anything to harm
anyone, why pick on them?" Elizabeth's anger was slowly
turning to sorrow and confusion.
Angela grabbed hold of Elizabeth's arm and moved closer to
comfort the now crying Elizabeth, "Of course they're not. People
are odd and do things we might least expect and want them to.
You've known what these people believed from when you were
young it can't have been that much of a shock to you."
Elizabeth felt comforted by Angela's arm on hers. She put her
head on Angela's shoulder feeling her smooth hair against her
head, "Hmm you've been using my shampoo again."
"Guilty," Angela retorted, "I've just had a thought. You knew
about this at an intellectual level but never at a personal one.
Anyone else would have just walked out or at least said your
piece and then walked out. Why did you stay? If you hated it so
much why did you stay there and lap up their worship as though
you were really Dr Bexley's daughter?"
"Look if you had four hundred people singing your praises I'm
sure you'd be flattered," Elizabeth retorted. The feelings of
exhalation were beginning to surface again. Elizabeth quickly
put them down and continued.
"Maybe but you sure as hell enjoyed it. I'm so sorry I put you
through that. There was one moment when you looked so much
like the 'hell bitch' it ran my blood cold. I've seen photos of her
and up until that moment you looked like her, same eyes, nose
everything but you had a certain air of naivete about you."
"Now what do you see?"
"The naivete has gone, at least for the moment. Don't worry too
much you're probably tired," Angela comforted Elizabeth once
more. She could feel Elizabeth's gentle crying on her shoulders
and it was all she could do not to join her. She was responsible
for the shattering of her friend's innocence and nothing she
could think of could make her feel better about it.
They walked back arm in arm. Well, Angela was nearly carrying
Elizabeth along. Elizabeth's eyes were red with tears and her
normal upright, confident stance had gone - replaced by a
despondent stooping walk. They arrived back at the apartment
and Angela unlocked the door and walked inside. She switched
on the coffee machine, retrieved some ice cream from the
cooler and handed Elizabeth a bowl and a spoon.
"What's this for? I just want to go to bed," Elizabeth said,
starting to get up.
"No you don't, not yet," Angela stated
"Make me," Elizabeth whispered.
"What can I say to make this better," Angela asked.
"Goodnight Elizabeth."
Angela had an idea. It was only a glimmering of one and it
would require a leap of faith on her part. "Elizabeth, I want to tell
you something. "
"What's that?"
Angela looked right at Elizabeth and said softly, "I know the
reason why you are so hurt about tonight. You've never trusted
anyone, ever. The only people you trust are your mom and dad
and they're a safe option for you. You know they love you and
will no matter what. When that guy said what he did about them
for a moment, just for a moment you believed him. Even the
trust you had built up for your parents wasn't enough to make
you doubt them when faced with a charismatic speaker of some
dumb cult. That's why you got hurt. You are ashamed of
yourself for believing him even for a moment, ashamed of
enjoying all the praise you were getting and shit scared that you
might turn out like the hell bitch. But there's no way you can, the
tests proved otherwise."
Elizabeth stayed silent. If only Angela knew the truth. She
sought to divert Angela away, "Mom was telling me the same
thing today. You're right, I need to trust someone, open myself
up to someone otherwise every single bitchy comment or lie will
get to me right here," Elizabeth pointed at her heart.
Angela sat down beside Elizabeth and made eye contact with
her, "Let me be that person. I don't know what it is but we just
connect you're becoming like a sister to me. Here I'll go first.
This is a secret that nobody except my parents know. If it got out
I'll lose my grant money, everything so I trust you with it. Fifteen
years of work and sacrifice by my parents will be wasted if this
gets out."
"What is it?" Elizabeth asked. She felt relieved that Angela had
made the first move.
"I'm adopted. My parents never registered me with the
authorities. They were afraid I'd be taken away from them if they
did. They got a forged birth entry and everything for me. If this
were ever found out I'd lose my grant and my parents would
face jail. They found me in the park, I was barely a few hours
old and nearly frozen to death. They took me in and raised me
as their own. I've no idea who my real family is or was but they
obviously didn't want me. Now mum and dad are the only family
I have or even want."
Angela's open admission had taken Elizabeth by surprise. What
she had just told her put her in a position of power over her. Just
one small slip and Angela Holden and her family were finished.
Elizabeth felt extremely flattered to be told such a thing. She
thought back what she'd been told about her mom and auntie
Cathline's friendship. How it had grown in a short space of time
to the point where it was nearly has strong as that between hers
and Matthew's. Kat was right, it was about time she trusted
someone else. But could Angela be trusted with her darkest
secret? Elizabeth considered the options, of any one she had
met, even Alex; Angela was the one person who had left herself
vulnerable to her. It was a big step for Angela to take and just
maybe it was time for her to take one of her own.
Elizabeth took a deep breath "Angela, what I'm about to tell you
is so secret that only three people in the world know about it. In
the same way as your life would be ruined if I told anyone about
your adoption then mine would be also. I would become an
exile, shunned by everyone I met and probably have to live my
life under armed guard."
Angela's eyes opened in curiosity. What was Elizabeth going to
say?
Elizabeth stood up, ensured that the curtains were closed and
walked over to check that nobody was listening at the door. She
took her PDA out and started to write.
"You were right about my reasons for being scared and angry at
the rally tonight."
"I knew that," Angela exclaimed.
Here goes Elizabeth thought and continued to write "All except
one thing. Me being scared of turning out like the hell bitch."
"What were you scared about then," Angela asked?
Elizabeth shook her head as if to say wait and then continued to
write, "I cannot turn out like the hell bitch, because I AM the hell
bitch."
Angela stared at Elizabeth and started to back away, "No! That's
not possible! She's dead! The tests!"
Fresh tears formed in Elizabeth's eyes and she stood up and
stood in front of a very shocked looking Angela. Elizabeth
continued to write.
"Of course she's dead! BUT every strand of my DNA is the
same as HERS."
"But I was told you were a clone of your dad?" Angela replied
Elizabeth scrubbed the writing from her PDA and started to write
on a clear screen, "That too was falsified. My dad has an IQ of
around 120 while mine is over 160. My brain is exactly the same
as HERS, right down to the same flaw that triggered the fury. As
for the tests they were rigged in order to cover this up. That's
why I was worried about the rally. If it can happen to HER it can
happen to ME!"
"I don't believe you," Angela was nearly in tears. She had
opened herself up, laid herself bare and now was Elizabeth
lying to her?
Elizabeth spoke for the first time. Her voice shaking and full of
apprehension, "Believe it, " she walked into her bedroom and
came out a few seconds later with a bottle of small white pills.
"What's this?" she asked.
"Your asthma medicine. You take it every day," Angela replied.
Elizabeth shook her head and mouthed "Olanzapine"
It was the last word Angela heard before she fainted. The
combined trauma of the last few hours, the extreme tiredness
she felt and now this revelation was just too much .
-- o -- o -- o--
Kat was unable to get to sleep, in spite of her plush
surroundings she was finding it hard to get comfortable. She
was worried about Elizabeth. She just hoped she'd done the
right thing by telling her to trust more, step out in trust to
someone and to be a little bit more impulsive. She couldn't help
but worry Elizabeth might do something stupid and ruin
everything.
Cathline was due to visit next week and perform her usual
counterbalance role. Their bringing up of Elizabeth was entering
its most crucial phase, the transition from a girl to a woman.
Her fears were allayed a little by Elizabeth's room mate Angela.
She seemed to be level headed and just the person Elizabeth
needed to trust. Kat wasn't really worried about Elizabeth
becoming another Dr Bexley it took an extreme situation to
trigger than off, it was more the other side of Elizabeth she was
concerned about. Elizabeth's emotional immaturity was the main
issue. Elizabeth had never loved or even had a romantic
relationship with anyone. The fear of them hurting her or the
other way around ran deep in her. In a way, Kat thought that
was their fault. They had hammered home what might happen
for so long, had they stifled Elizabeth's emotional growth?
Kat considered that they had, probably out of their own fear put
the fear of God into Elizabeth about her true mother. Should they
now withdraw more and let things take their own course? That
certainly seemed to be the preferable option. Keep an eye
on her and drop in from time to time. Kat though she needed to
take some of her own advice. She had to learn to trust that
Elizabeth knew what she was doing. Kat checked the bedside
clock it was nearly 4am she really must try and get some sleep.
-- o -- o -- o--
Elizabeth awoke early the next morning. After carrying the still
unconscious Angela to her bed she had just managed to make it
to her own bed before collapsing in a heap. That had been one
hell of a night! Had her admission ruined the blooming
friendship between her and Angela? There was only one way to
find out.
"I thought I'd make you breakfast in bed," Elizabeth said
carrying in a tray of muslei and a steaming hot cup of coffee.
Angela sat up in bed and took the tray, "Thanks, you needn't
have."
"We need to talk. Not here, somewhere private. Look about last
night, I...," Elizabeth started.
"It's ok. I was just a little shocked that's all. Let me eat this,
throw on some clothes, and we'll go out for a walk,"
"Deal," Elizabeth smiled. That had gone easier than she expected.
Elizabeth decided that she needed cheering up so she fished
out her best Beckham-Kline outfit, straightened out what
remained of her hair and applied some makeup. It felt good to
feel smart for a change. This living in jeans, cheap skirt-pants,
and sweaters was making her feel less like a woman and more
like a garage sale.
Angela emerged wearing her standard issue jeans and T shirt
she took a mock step back in amazement as she saw Elizabeth
standing there looking like a million dollars. From the cut of her
skirt-pants to the exquisite cut of her blouse Elizabeth looked
every inch the millionaire's daughter. Angela had never noticed
before how Elizabeth's face had an air of supreme confidence
about it, of infallible intellect and of determination to succeed at
any cost.
"Ready?" Elizabeth asked.
"You look, you look amazing. I need to change," Angela stated,
and turned to go into her room.
"No you don't! I just wanted to give the non-dowdy me an air,
that's all. Come on, let's go, I've got a lecture at 11." Elizabeth
smiled and beckoned for Angela to follow her.
They talked about this and that and Angela nearly blurted her
coffee out when Elizabeth told her that her outfit had cost about
twenty thousand dollars. To Angela it rubbed in the gulf that was
still between them. They reached a secluded cake shop and sat
down outside. The summer was wearing a bit thin now but even
in this early October day it was pleasantly warm. Elizabeth had
gotten wolf whistles and looks from nearly every man they
passed. Angela decided that dressing this way was Elizabeth's
attempt to feel normal again. As they sat down and waited for
the croissant's to arrive Elizabeth asked, "Well?"
"Well what?" Angela replied taking a sip of her cappuccino.
"Last night. We need to clear the air. I need to know where we
stand?"
"The same as before. I'm sorry for that fainting business -- it made
it seem worse than it is. I'm not worried about being stabbed
while I sleep if that's what you are concerned about. So my
roomie is the hell bitches daughter. So what! You might have
been gay, or even worse American!," Angela teased.
"But I am Amer...," Elizabeth started.
"I know you are. I just want you to know that you did the right
thing telling me. You're secret is safe with me. At least you know
who your mother is. See, to me, it's the environment you come
from not which set of genes you have. Hell, I could be Dr
Bexley's illegitimate daughter for all I know BUT I do know that I
was brought up very well and love my family. It makes no odds
to someone who's adopted which set of genes a person has. It's
who they are that's the important thing and you young lady are
far too well adjusted, clever and compassionate to ever be a hell
bitch," Angela saw that her words had had the desired effect.
Elizabeth now looked a lot happier than she had before.
"Thanks Angela. I was really worried when I woke up this
morning. I was afraid I'd blown it both with you and with the
whole cult thing."
Angela shook her head as if to disprove Elizabeth's statement,
"Now I understand why you reacted like you did. Hearing them
talk about your parents like that and then them treating you like
some kind of goddess must have really spooked you. Knowing
who you are makes the whole thing ten times worse."
"So there's not any part of you that's the least bit worried about
me?" Elizabeth asked.
"Listen witch, I am worried about you but not about the hell bitch
thing,"
"Then what!" Elizabeth demanded.
"There's a very cute guy over there who hasn't been able to take
his eyes off you since we got here and you haven't even smiled
at him," Angela smiled at Elizabeth.
Elizabeth gave Angela A big grin, the relief of being accepted for
who she really was like a weight that had been lifted from her. At
long last she was starting to feel free of the ghost of Dr
Elizabeth Anne Bexley.
-- o -- o -- o--
Anne climbed up the ladder into the gently rocking boat. She
had spent an exhilarating couple of hours taking samples of
invertebrates and coral from the Med. They were always the first
to feel the effects of pollution. Her re-breather was almost
exhausted, as she was. It wasn't the shell fish, coral and other
invertebrates that gave her the buzz, it was the experience of
freedom and of oneness with nature. Wearily she stripped off
her wetsuit, revealing her bikini and tanned body. She walked
into the laboratory area and saw Steve, her colleague poring
over a computer screen.
"How's it looking?" She asked.
"Not good. Fuel cell number three is playing up. I'm getting a
'Main Bus B Undervolt' warning light on the main panel. We
should be ok for the trip back but I'll go look at it in a while. As
for the samples, Sulfur levels have risen by nearly eight per cent
since 1992. Mercury is up too and as for the O2 content that's
down by four per cent. The Vesuvius eruption back in 08 didn't
help much. Most of this, what we're seeing here, is down to that.
But for these poor guys it doesn't matter where it comes from.
Only that it makes their life a lot harder," Steve gestured to the
array of sample jars littering the lab table.
"I know. First of all the bacteria are affected, then the plankton,
then the invertebrates and it just cascades down from there and
before you know it the whole ecosystem has collapsed. We
know what's going on but with our current tech and funding we
can't stop it. There's nothing we can do about volcanic activity
but what we're doing to the ocean sure as hell isn't helping,"
Anne said bitterly.
"If what we think is happening here is actually happening then
we may have a chance to save the ecosystem but it'll take
another twenty years before we can really start work. By the
way, how's the new re-breathers working out?" Steve asked. He
cared about the impending collapse of the global marine
ecosystems as much as Anne did but Anne was by far the more
fanatical about it.
"Great! No mucking around with decompression, heavy tanks or
worrying about running out of air. They must have cost a
fortune. It's nearly as good as having gills."
"And of course you'd know what having gills was like?" Steve
teased.
"Ok I'll let you go down next time ok," Anne said taking the hint.
Steve plucked up courage to ask a question he had been dying
to ask since he first saw this tall, blonde and stunningly beautiful
research student. Even after an exhausting two hour dive she
glowed. Steve had to admit that there were elements of a
younger Rachel Martin about her but Anne was far more
realistic than that image of impossible female perfection.
"Anne?"
"Yep?" Anne replied. She was busy tying her hair back into its
characteristic ponytail.
Here goes, Steve thought, "I was wondering if you'd like to have
dinner with me?"
"I have dinner with you every day" Anne replied.
"No! I meant Dinner, candles, restaurant y'know."
"You mean a date?" Anne asked.
Now Steve was even more worried, "umm yes, if you like."
Anne gave Steve a smile, "How do you know I'm not some kind
of nightmare cannibal surf babe? You know virtually nothing
about me."
"But I want to find out. We've been working together for nearly
six weeks and you've told me nothing about yourself," Steve
stated.
"There's nothing to tell. My parents died several years ago. I'm
putting myself thru college using the money they left behind,"
Anne said. She was not sure at all if she wanted to get back into
the dating game, let alone with Steve.
"Ok let me take you out as a friend then." Back to plan B Steve
thought.
Anne had an impulsive thought, "No I'll go as your date. It's
about time I had a little fun."
Steve couldn't believe his ears, "That's, that's great! We're due
back at 6 so I guess I'll pick you up at 8."
Anne gave Steve a devastating smile, "That'd be great. Now
back to business. We've got to go back to the traps we sent just
back on the continental shelf just off of Netanya. It should only
take us a couple of hours to get there. That should give me time
to recharge the re-breathers and to have a rest."
"Hey when is it my turn?" Steve complained
"Over dinner. I do the diving, you do the paying," Anne smiled.
Steve shook his head in mock disbelief. How could such a
wonderful woman as Anne Baxter ever agree to go out with
him? However unlikely it seemed, she just had.
-- o -- o -- o--
"Welcome Ms Stephens. Your parents are at a table in the
garden atrium," the doorman gestured for Elizabeth to turn to
the left.
Elizabeth gave the doorman a thank you smile and walked into
the exquisite surroundings of the Langam Hilton. She felt just
like the hotel looked, just like a million dollars. Her new outfit
was absolutely stunning in conception. It hung on her as though
suspended by an invisible thread, went in, and out in all the right
places. The slit in the dress up her right leg exposed her
shapely thigh, and the fact the dress left her entire back exposed
save the curve of her ass made her the image of every
teenager's wet dream. Angela had been blown away by its
elegance as she was picked by limousine from outside of her
apartment. Angela had asked how much the outfit and
hairstyling had cost but Elizabeth had refused. Fifty thousand
Euro's was a lot of money -- all Elizabeth would say that it was
enough. When getting dressed Elizabeth had noticed she was
getting a little out of shape and vowed to spend at least two
hours a day in the pool and gym to keep herself in tip top shape.
As she walked into the marble floored atrium she caught sight of
Matthew and Kat laughing over a bottle of champagne. At the
sight of her Matthew shook his head in mock disapproval while
Kat just mouth "WOW".
Elizabeth smiled, she knew she looked wow. It made her feel
better. A waiter saw her approach the table, and offered her a
seat next to Kat. Elizabeth sat down, poured herself a glass of
champagne and breathed a sigh of relief.
"You ok little mite?" Matthew asked.
"Just tired that's all, " Elizabeth said, taking a sip of the still cold
champagne.
"You could have saved some of that fifty grand we gave you. At
this rate we'll be broke and living in single roomed apartment in
Delaware," Matthew stated.
"Sorry dad. Mom did say get something nice."
"I'm not telling you off but Angela must have felt awful. There
aren't many students who walk around in designer outfits or go
to six star restaurants for meals," Matthew said.
They were interrupted by a very smart looking waiter who
passed them the menus, swapped the bottle of champagne for
a new one, and then retreated to allow his honored guests some
time to consider their choices.
"Why come here? We could've gone to a place in Cambridge or
New London?" Elizabeth asked.
Kat nodded, "Yes we could have but we wanted to give you a
treat. We haven't seen you for nearly two months and wanted
the chance to be a real family again. We're helping senator
Jameson prepare for his presidential campaign, and so as that
ramps up we'll have less and less time to visit you. We're sorry
that we can't spend all the time with you, but this is important."
Elizabeth understood that Kat was saying 'you're a big girl
now'. She thought for a few moments, considered all the options
and then said, "Mom, Dad, last night I did two very stupid things.
Well one was very stupid the other hasn't turned out too bad so
far."
"What did you do? Did you have a fight with Angela?" Kat
asked.
"Worse. Angela thought it would be a laugh if we went to a
Children of Bexley Rally," Elizabeth said guiltily.
"WHAT!" Matthew roared, and then looked hurriedly around at
the rest of the guests staring at them.
"I'm sorry dad. It seemed like a fun thing to do, to get them all
wound up, get them back for all the grief they put us thru."
Elizabeth knew she'd be in a for hard time but honesty was
always the best policy, especially when parents were
concerned.
"What happened?" Kat asked, the concern was evident on her
face. "Did they hurt you?"
"No, that was the thing. We sat there and listened to their high
priest or whatever he's called. He started saying all these
horrible things about you and I just lost it. I stood up and called
him a liar."
"Then what did he do?"
"He bowed down and worshipped me. He called me Dr Bexley's
daughter. They don't know, do they?" Elizabeth said worriedly.
"How can they know? Even a DNA test doesn't give any hint of
who you are. You have to combine a CAT scan with DNA tests
in order to pick up the difference in yours and Matthew's brain
structure. We are the only people with that information. What on
earth made you do such a stupid stunt?" Kat said, trying to
placate Elizabeth's concern.
"I was trying to step out in trust, be a little impulsive just like you
said. Besides, I was getting too old and boring. I needed a thrill,"
Elizabeth said defensively.
"You get that side from your mother. Then what happened?"
Matthew quipped.
"Angela got spooked, I mean really spooked and dragged me
out, then we went home."
"How did you feel when they said those things and when they
were worshipping you?" Kat asked curiously.
Elizabeth had heard that tone several times before. It was Kat's
way of acting out of curiosity but not showing the deep heart felt
concern she was really feeling. "I felt furious at them. I wanted
to take them down for what they were saying about you and
then when they were kneeling down in front of me calling me
blessed daughter and all that I felt elated. It was as if I was
being lifted up into the heavenly realms. Angela pulled me out
before I was sucked in any more."
"Sounds as though she did the right thing. You have been taking
your asthma medicine haven't you?" Matthew stated.
"Of course. Look you guys would be mad if you heard what they
said and to have four hundred people kneeling in front of you
was, shall we say a unique experience," Elizabeth game
Matthew a 'come on I'm ok now' kind of look.
"So what's the second stupid thing you did?" Kat asked wearily.
"I told Angela who I really was. She'd opened up to me and told
me her innermost secret and I need to trust someone. I've
chosen her. Are you going to bawl me out about that one?"
Kat shook her head, "No. That's a positive step. Not that you
should be telling everyone, but we trust you're a good judge of
character. I am angry about what they accuse Matthew, Cathline
and me of. To answer the other question, yes I would probably have
hit the roof. Cathline certainly would. I wouldn't worry too much
about it. As long as you stay away from them you'll be fine."
"Mom, Dad?" Elizabeth queried.
"Yep?" Matthew asked.
"I love you", Elizabeth said with a tear in her eye. They always
had a way of making everything seem much better.
-- o -- o -- o--
"GPS makes the spot! We're here!" Steve called out to Anne,
who was busily attaching the small cylindrical re-breathers to the
belt of her wetsuit.
"Ok. How far from the coast are we?" Anne called out.
"About forty miles, "It'll take a couple of hours to get back but
this shouldn't take long. Fuel Cell three still playing up. I'll have a
go at fixing or replacing it while you're busy with the fishes,"
Steve said. Had Anne forgotten about their date already?
"If we can get it going it'd be great. I'd hate to be stranded out
here with a nice free meal waiting for me, "Anne smiled.
So she hadn't forgotten. "I thought you'd be paying, seeing as
your always saying what a twenty first century woman you are"
Anne gave Steve another heart melting smile, "I may live the
third millennium but when it comes to matters of the heart,
stomach and especially money I'm strictly second millennium."
Steve gave his best smile in return. It was going well. "Whatever
you say dear. Now are we going to get those traps or not?"
"Ok. Want to check everything for me?" Anne asked. When
diving alone the cardinal rule was to have someone else check
you're equipment and let them know exactly what you planned
to do and go.
"Sure," Steve walked up and started checking Anne's re-breathers,
depth gauge, emergency air, a length of rope, shark repellant,
and all the other gear she had on. He tried not to notice how
snugly her wetsuit stuck to her skin or how the shape of her was
as close to perfection as he could imagine. Now was not the
time for distractions -- someone's life depended on how well he
checked the equipment. A few moments later he announced,
"You're fine. See you in an hour. I'll replace fuel cell three while
you've gone. Bye."
Anne gave the ok signal and climbed down the ladder. After,
clearing her mask, ducking underwater and testing the
functionality of the re-breathers she gave Steve a last 'ok' signal
and swam beneath the waves.
It took her almost twenty minutes to reach the crustacean traps
they had laid a few days before. The plan was to catch a few
lobsters, crabs or octopus and analyze them for signs of being
affected by degradation of O2 in the water. One by one they
were empty. That was odd, she thought they should have been
mostly all full. Surely the population hadn't degraded that much
since the last survey was done a year ago?
After another five minutes she found two traps that contained a
lobster each, so she untied them from the mooring anchor and
went to inspect the others. They too were empty. She checked
her watch; it was time to be heading back. She still had time to
have a quick detour, Steve wouldn't mind. This close to the sea
floor there must be something interesting to see. She slowly
swam downwards, thankful that she didn't have to suffer
decompression. She swam down until she could hardly see the
hand in front of her face. Strange the water shouldn't be this
murky? She switched on the powerful flashlight attached to her
wrist and proceeded to explore. What had caused this
disturbance?
The water grew ever darker and more churned up as she swam
on. Every instinct told her to withdraw. Don't mess with what you
don't understand was the rule that had been drummed into her.
She could feel her heart beat getting quicker and quicker until it
seemed to make the water vibrate. She found herself
hyperventilating. The re-breathers could only take so much
oxygen from the water; if she didn't calm down she would
overload them. She stopped swimming for a few moments to
calm herself down -- after all the sea was her friend. It and she had
been long time companions and she told herself that the bond
between them would still be there. This had the desired effect
and she then continued on. Suddenly she felt something touch
her leg and almost screamed in shock. She whirled around to
see what it was and saw only murky water. Steeling herself and
overcome with curiosity she swam down to where she thought
the object had gone. A few seconds later she saw a large object
about six feet in length and very dim in outline. The current was
gently carrying it away as though drifting on a breeze. She
swam closer to it, shining the flashlight at it all times. Then, right
out of the murky water leapt the burned remains of someone's
face. Its skin was almost all gone, as was most of the hair.
Anne nearly spat out the regulator in horror. She recognized
what remained of the face. It was Steve!
Putting aside her feelings as best she could she swam towards
Steve's body. She had to find out what had happened to him.
Now knowing what to expect it was a little easier when she
finally managed to get a clear glimpse of his body. A leg was
missing, as was most of his chest. Her medical training kicked
in, as did her scientific detachment. It was her defense against
emotional trauma. Whatever had happened to Steve it had been
quick and violent. It must have been some kind of explosion.
Her heart sank; she now knew what had caused the water to be
all churned up. There had been an explosion on board the boat,
it had killed Steve, and as the boat sank it churned up the water
around it. She was alone and stranded forty miles from shore.
Forgetting all about the lobster traps she managed to grab hold
of Steve's lifeless arm. She owed it to his family to try and return
his body for them. Working as best as she could she tied the
rope around his torso and attached the other end to her belt.
Feeling the weight of Steve's body behind her was making her
progress slow, and it took her more than half an hour to reach
the surface. Anne checked the re-breathers -- they now had less
than an hours worth of charge left to them. Anne looked around
to see if she could find anything worth using as a life raft, but
everything of any size had sunk with the boat. Flares, life rafts
and everything were now making their way to the bottom of the
Mediterranean. There would be no telling where or how deep it
was by now. Judging by the lack of flotsam and debris there
wouldn't be much recoverable. She couldn't even see the
emergency mayday beacon that was supposed to deploy in the
event of the ship sinking. Anne took her bearings from the sun,
checked her wrist compass. There was nothing else for it. With
no life preservers, rafts or useable floating material she would
have to swim until she was picked up, made it to shore or
drowned. There was one option open to her, it was an extreme
one and very, very risky but it was she quickly decided, the only
viable option left. Taking a deep breath she set out towards the
shore.
-- o -- o -- o--
One Day Later
-----------------------
"That's odd," Wills commented. Pointing at an entry on his PDA
"What is?" Mark asked.
"This dream woman of yours. She's never been ill, gone to
hospital, had a day off sick or anything," Wills stated.
"So?"
"Just think it's odd that's all. Look I've pulled down everything I
can find out about her, net white pages everything. Short of
spending all week at this you've seen everything about her that I
can find out,"
"Sure, thanks. I owe you one," Mark said. In the last hour or so
he'd learned lots about his dream woman. Her real name was
Elizabeth Anne Baxter. She'd lost both parents in an auto
accident a number of years back. Her SAT scores and grades
were way above average. She'd studied for a medical degree
before switching to Marine Biology and Zoology. What else had
he found out? That was it, she owned a late 2000 model year
Porsche, very nice. No speeding tickets, convictions or anything.
Average credit rating for a Ph.D. student, no outstanding debts.
From what Wills had found out she was just a normal well
balanced one hundred and ten percent babe.
"Mark I think you should see this. I was looking for any new
information on her. Wills voice had dropped to a serious tone.
He handed over his PDA to a worried looked Mark.
Mark stifled a cry of horror when he read the article.
"Two feared lost as research boat sinks with all hands.
Two promising students were feared dead when they failed to
return from a routine survey of the Mediterranean. Steven
Mercer(28) an experienced sailor and marine biology researcher
and his assistant Elizabeth Anne Baxter(24) are feared lost
when their boat 'the 'Anna-Maria' failed to rendezvous at the
agreed point.
Infra red detection and search and rescue aircraft were sent out
after Israeli coastguards detected an automatic mayday signal.
On reaching the last known position of the Anna-Maria,
wreckage was detected on the ocean floor as were several
smaller fragments floating on the surface. It is thought that the
boat exploded due to a faulty fuel cell but the black box recorder
has yet to be discovered."
"No it can't be true. Not like this," Mark was looking distraught.
"What else does it say," Wills said softly.
Hardly daring to read on Mark continued.
"Divers were dispatched to investigate the wreck and as yet no
bodies have been found. The search continues but is being
hampered by bad weather."
"They haven't found the bodies yet. But I guess it's only a matter
of time. I was so sure she was the one." Mark was now in a
state of shock.
"Come on Mark, I'll get you a beer," Wills said, helping Mark to
his feet.
"I don't feel much like a beer," Mark muttered. He felt as though
he had been kicked in the stomach and that his life would never
be the same again.
-- o -- o -- o--
Elizabeth flopped down on the bed after a hard day's tutorials
and lectures. The workload had suddenly hit them and neither of
them had much time for picnics, cult visits or even just chilling
out. Elizabeth of course had made light work of her coursework,
but she had decided to read around the subject and was also
assisting Angela in hers.
"When was the first successful use of stem cell regeneration for
severe spinal injuries?" Elizabeth asked.
Angela smiled, knew this one "2001 on Detective Tina Cox. The
late Dr Elizabeth Bexley performed the operation. She used
stem cells to re-grow the damaged part of the spine, and so
restore Detective Cox to full health."
"That's not what it says here. It says a Dr Alice Woodward
carried out the procedure on Robert Sykes in 2009."
Angela looked puzzled, "So what about Tina Cox? How was she
cured?
"The late Dr Bexley injected her with a slow acting DNA
modification drug which slowly regenerated her body. It needed
to be slow acting because of Detective Cox's critical condition."
Angela shrugged her shoulders "Ok. Fine."
Elizabeth read the next question from her PDA. "Ok, next
question. Who postulated the 'cold boot' theory for the treatment
of extreme personality disorders?"
Angela smiled she knew this one, "Dr. Yuri Kopaev of the
Ivanovo State Medical Academy back in umm 2012."
Elizabeth nodded, "See you do know this stuff. Ok next
question. What's the theory?"
Angela shrugged "Dunno, something like you induce a deep
coma and then when they wake up they're better?"
Elizabeth read the answer from her PDA "Close enough. Pass
me your PDA, and let me have a look at your gene sequencing
work."
Angela sighed. Elizabeth was so much better at this than she
was. She reached across and picked up her PDA and passed it
to Elizabeth
"No the sequence goes ACTTGA not ACCTGA," Elizabeth was
explaining to Angela.
"Why?"
Elizabeth was getting a little frustrated, "Did you go to the
lecture? It's all down to the proteins in the nucleic acid, that's
what makes it switch like that."
"I see. Sorry if I'm being dumb," Angela was finding the course
hard going now.
"That's ok. I guess I've guess I've just got a natural flair for this
kind of thing. You wanna take a break?" Elizabeth asked.
Angela was looking bored and frustrated.
"I'd better not. I need to understand this stuff before next week.
Would you mind leaving me alone for an hour or so?" Angela
said.
"I've a better idea come out for ice cream with me?" Elizabeth
pleaded.
"No I have to do this?"
"Angela you come out with me and I'll tell you my secret for
doing all this genetics stuff," Elizabeth knew Angela needed a
rest. At this rate she would burn out and that would be
disastrous.
Angela resigned herself to Elizabeth's pleading. Not that a nice
ice cream would help things somewhat, "OK you win."
Ten minutes later they were sitting down in their favorite ice
cream joint, waiting for two oddly named knickerbocker glories.
"Ok then what's your secret?" Angela demanded.
"Ah ah," Elizabeth shook her head. Not yet,
"I want to say sorry, "Elizabeth said softly.
"What for?"
"The other night. Waltzing around in that outfit like some spoilt
rich kid. There's you getting more and more wound up that you'll
fail your parents, and then me looking and acting like I own the
place. Sorry," Elizabeth felt relieved. That thought had been on
her mind since two days ago.
"I must admit I did find it odd. But don't worry, if you have it use
it. I know I can't compete and I don't want to either. I'm happy to
be me. So if you want to blow fifty grand on an outfit, then that's
fine as long as you don't expect me to match you, because I
can't."
"How'd you know the outfit cost fifty grand?" Elizabeth queried.
"You made the inside covers of one of the tabloids. It told me
where you got it and how much you paid for it. I dunno how your
parents have done it, but they do a good job of keeping your life
private," Angela commented.
"I glad it is mostly private. I just give them a few photo's every so
often and it keeps them happy. Now I promised to show you
how I do it," Elizabeth said.
"Go on. Is this how your mother did it? Angela asked.
Elizabeth wasn't hurt by this comment. The thought had crossed
her mind too and sharing with Angela would help the process,
"I've no idea. I guess so. It seems so logical that it has to be the
way."
"Go on then, I'm dying of suspense," Angela said eagerly.
"Ok then. I see the genetic structure in my mind. It's like a 3D
model. I can rotate it, insert and remove genes, proteins etc at
will and picture the new form in my mind. It's like when you
listen to music with your eyes closed. You can feel the way the
music will flow. I do the same with genetics. Actually I can do it
with most other things. I use it for organizing my workload,
decision making and planning. By using my mind modeling as I
call it I can factor nearly all the permutations of a problem very
quickly. I see the right path to take even before I've engaged my
thought processes. If I process information like HER then it's a
good guess as to how she was able to out plan and out think
everyone she encountered."
Angela closed her eyes and concentrated but nothing
happened, "It's no good," she complained.
Elizabeth thought of another way to try and explain it, "It takes
practice. I've been doing it since the age of four. Look at this
way. Mozart could 'think in music'. 'He didn't think 'I'll stick a C
flat there and then a B'. It flowed from him like writing does an
author in full flow, like painting a masterpiece does to an artist.
That's what I'm saying. I can't think in music but I can in
permutations. Genetics is one long string of permutations, the
fury was permutations of vengeance, what the hell bitch did to
try and rectify that was a string of permutations as well. How she
did what she did wasn't mystical or superhuman she was just
exceptional at this 'thinking in permutations'".
Angela had a thought, "Are you as exceptional at it as she
was?"
Elizabeth ignored the unsaid sentence in the question, 'could
you do what she did?' Instead she answered, "In my opinion,
and from what I've seen of her work before the Fury and at med.
school I'm even better at it than she was," Elizabeth's tone
wasn't proud or boastful; she was just stating a fact.
-- o -- o -- o--
"Mr and Mrs Mercer. The body is just thru here," the mortician
gestured towards an operating table. The shape of a body lay
underneath a white sheet.
The couple held hands, still in shock and fear as to what they
might see. Slowly they walked over to the table and lifted the
sheet. The woman let out a gasp and clutched her husband. His
face was as white as marble and as emotionless as stone. He
had just taken the shock in a different way to his wife.
The man was the first to speak, "Yes doctor it's him. We need a
few moments alone. May we see the woman who recovered the
body?"
"Sure take as long as you like. I'll be outside when you've done,"
the mortician replied sympathetically.
The man nodded, "Thank you doctor."
In another part of the hospital a very tired, sun burned, and
disheveled looking Anne Baxter was being quizzed by the
police, coast guard, and accident investigators.
Anne was very tired and needed to rest and it was beginning to
show in her voice "As I said before Steve had told me that fuel
cell number three was playing up and he was going to change it
while I retrieved the lobster traps. That was the last I knew until I
saw Steve's body drifting away,"
"Did you see the 'Anna-Maria' when you were down there?" the
coast guard asked.
"No I was running low on re-breather power and judging by the
state of all the debris there wasn't much left of it."
The police officer checked his PDA for the notes he'd made
during the interview, "OK let me get this right. Your boat blows
up."
Anne nodded wearily.
"You're forty miles from shore with no flares, life boats or life
preservers."
Anne answered "Yep"
"No fresh water, no food, limited time available to you for your
re-breathers."
"Correct, officer," Anne replied.
"Officer, where's this leading to? She needs rest, lots of it." The
doctor who had given Anne the all clear now tried to stop the
questioning. Anne needed rest desperately. The doctor was
concerned. They had been questioning Anne for ages and she
urgently needed her rest.
"Humor me doctor", the policeman replied. "Now where were
we, Oh yes. If that's not enough to handicap you you've got a
200 pound corpse tied to you."
"I guess so," Anne saw where this was leading to.
"So Ms Baxter please could you tell us how in hell you managed
to swim forty miles, towing a grown man with no water, no food,
no life preserver and no life raft. You then turn up, nearly two
days later up at some fishing village very tired, sunburned but
otherwise none the worse for your ordeal. That's twenty miles a
day for two days. Something doesn't add up here," The
policeman stated.
"Just what are you trying to say, officer?" Anne demanded.
The policeman continued his line of questioning. "Ok then how
about this. You're towing a half dismembered corpse, You're a
target for every shark or barracuda for a hundred miles yet the
body is untouched and you haven't a mark on you. How come?"
"Are you trying to suggest that I somehow blew the boat up forty
miles from shore, leaving myself an almost impossible task to
get back, and to add to that I tow my murder victim's body behind
me all the way," Anne was now sounding more and more
outraged.
"Not at all, just tell us how you did it," the policeman asked.
"I've already told the coast guard, but I'll repeat it just one more
time. After that read the book," Anne snapped.
"Go on. The PDA is recording, " the policeman stated.
"Ok, first things first. I owed it to Steve to bring his body back to
his family. I wasn't there when my parents were killed, I never
got the chance to say goodbye to them, and it's that memory that
has haunted me ever since. I still had a full compliment of shark
repellant so I set it to slow release, just enough to mask the
blood still seeping from him. To make it last longer I stripped off
my wetsuit, placed the repellant inside his chest and put the
wetsuit on him. That way he was as sealed in as I could get
him."
"That was some feat doing all that without dropping anything,"
the policeman said.
"I did drop a few things. Which is why I was glad of my re-
breather. Anyway, that was Steve dealt with. The next thing on
the agenda was how in hell was I going to make it back to
shore. As Mr Coastguard over there knows, over the past year or
so the pattern of currents is slowly changing. It's been playing
havoc with fish stock, everything. Anyway because we were
tracking the plankton we needed to follow the currents quite
closely."
"I get it!" the coastguard exclaimed,
"Yep. I swam in the current all the time. The amount of
effort required dropped from a forty mile swim down to a more
modest thirty. To conserve energy I drifted, swimming only to
maintain course. Halfway thru the first day I found a piece of
wood large enough to put Steve onto. After lashing him to it I
towed it like a raft. Steve didn't need my wetsuit anymore so I
put it back on. I needed it more than he did. Eventually I
reached a small fishing village and managed to rise the alarm.
Are we any closer to finding out what happened?"
The accident investigator shrugged. "We think it was the fuel
cell. They were a very old design. Our initial guess is that cell
three must have cracked open. It would have been ok, but
Steve probably moved it when he replaced it. That could have
released a large amount of hydrogen and oxygen into the
engine room. All it would take is a spark from a light switch and
the whole boat would have gone up. The other fuel cells would
probably have split too, just adding to the destruction.
"I thought fuel cells were nearly indestructible and have multiple
failsafes?" the policeman asked.
"They are and they do. I'm not an expert on this, I'm just reading
what it says here. It's probable that a manufacturing fault was to
blame, and it only appeared when the cell was being swapped
out. These things last for years so this may well have been the
first time it had been swapped out. Anyway, at the moment it
looks as though moving it caused it to explode. We can't know
for sure for a while yet. There's not much left to look at."
The conversation was interrupted by a knock at the door. A
nurse popped her head around the corner, "Anne, Mr and Mrs
Mercer would like a word with you"
"It's ok. I think we're done here aren't we?" Anne asked
hopefully.
"I think so. We'll come back tomorrow if that's ok?" the
policeman stated. Switching off his PDA and putting it inside his
pocket. The other two men nodded their agreement, collected
their notes and left the room.
Anne didn't have much time to recover from her grilling, and in
one way she preferred the all at once approach. She'd had little
time to think on Steve and how exactly she felt about his loss.
Her train of thought was lost as a couple dressed in somber
fashion walked in holding hands. Anne stood up and asked, "Mr
and Mrs Mercer?"
The man nodded, and sat down on the chair the policeman had
occupied some moments before. "We've, we've come to say
thank you," the man's voice was cracking with emotion. His wife,
her eyes red with tears sat studying Anne.
"That's ok. I'm so, so sorry. I wish I had been there. Maybe I
could have done more," Anne said softly.
The woman spoke for the first time. Her voice was quiet and
shaky, "You did more than anyone ever expected you to do.
Please don't blame yourself."
"Jo's right. You could have left him at the bottom of the sea but
you risked your life to bring him back to us. We can bury him
properly, say good bye properly and remember him, as we
always will. You have given him back to us, and that is a dept
we can never repay," The man said. His voice was now firmer
and calmer than before.
Anne decided to open up to this people. They needed the
answers to those questions, "When I was down there and saw
his body. I could only think of when my parents were killed. I
was away at the time and never got the chance to say goodbye
to them properly. It still plays on my mind from time to time that I
never got that chance. I knew as Steve drifted away from me
that I had to save some else the same pain that I went thru."
"Thank you is all we can say. What was Steve's mood like when
you left him?" Jo asked.
Anne saw thru the question 'Did my son die contented? Can I
regard his life as happy one?' "He was very happy. He'd asked
me on a date earlier on in the day. I don't date just anyone, but
Steve was fun to be around and we got on really well so I'd
agreed. We'd spent much of the rest of the day talking about it,
him especially. I'll always remember him in that way. Yes he
was very happy when I left him"
Jo let out a small stifled sob and was immediately comforted by
her husband who then said, "Thank you. Steve was a quiet and
thoughtful son. He was always a little shy around women. The
fact you agreed to go out with him would have given him more
pleasure than you can imagine. It helps to think of him that way;
getting ready for a date with you. I bet he teased you about
paying, he always wanted to be the gentleman."
Anne gave a smile and nodded. Fresh tears formed in her eyes
"Yes he did and yes he was, a perfect gentleman. You should
be very proud of him. We had sent some unusual findings to the
university. Well they were Steve's findings. I did the diving, he
did the studying. If they show what we think they show, we have
a small chance to make a real difference. His life wasn't wasted
at all."
Jo looked Anne in the eyes, "No it wasn't was it? It brought you
to us. I'm sure your parents wherever they are would be very
proud of what you did for Steve and us. Please come to his
funeral. We want you to come."
"Mr and Mrs Mercer?" Anne said.
"Jo and Karl please," Karl replied
"Ok, Jo and Karl. I will be there, I promise," Anne said with such
determination that Jo and Karl knew that nothing in heaven and
earth would stop this remarkable young woman from attending
their son's funeral.
"They told us the boat blew up when Steve went to change the
fuel cell, is that what you think happened?" Karl asked.
'Did my son cause this?' was how Anne took the question, "The
fuel cell was old and probably had a defect that only showed it's
self when it was removed. That's the line they are using at the
moment. They don't think there's any causative action on it. The
maintenance was up to date and it had all been checked. It was
just a terrible accident. Steve wasn't to blame, he always
checked everything again and again."
Karl scribbled a note down on a scrap of paper, "Ms Baxter,
here is our address in Utah. We'll send you the funeral details
as soon as we know them."
"I'll be there," Anne promised.
"We know you will," Karl said quietly.
"We have to leave now, we have so much to prepare and it's the
hardest job in the world at the moment," Jo stated.
Anne nodded, "Thank you for coming. I appreciate your visit.
Thank you."
Jo stood up and gave Anne a large hug, "Thank you so much."
New tears formed in her eyes and Anne returned the embrace.
The next few days were going to be very hard on Jo and Karl
Mercer and they would need all the comfort they could get.
-- o -- o -- o--
The next day Wills, clutching his PDA ran up the five flights of
stairs to Mark's room. The elevators had been out of order and
this couldn't wait. Out of breath he managed to rap a staccato
knock on Mark's door. "Mark. Wake up, " he managed to rasp.
"Mog off!" Mark shouted thru the door.
"Mark open up. There's some news just in," Wills called. He was
slowly catching his breath.
Wills heard a shuffling sound come to the door and was faced
with a bedraggled Mark. His hair was unkempt and unwashed.
Deep dark rings were around each eye and his face looked as
though it belonged to a much older version of himself, "Uh huh?"
Mark grunted.
"Look at this!" Wills thrust his PDA into Marks face.
"I'm not in the mood for games," Mark snarled.
Unable to contain the news any longer Wills blurted "She alive.
Your dream woman, Anne Baxter she's turned up. A little
sunburned, utterly exhausted but she IS alive."
"You what! Come in, sorry bout the mess," Mark said. His face
showing distinct signs of unbelief.
Mark's room was normally quite tidy for a single guy, but this
looked as though it had been trashed by a drunken, but very
angry heard of elephants. Clothes were scattered all over the
floor, mugs were placed on every level surface. An empty Pizza
box was on the floor, its half eaten contents was still visible as it
was draped over the side of the box. Wills was a little stunned.
He had never seen his friend like this before, let alone over a
woman he'd never even spoken to.
"Mark, Listen to me. She's alive."
"I heard that bit! How come?"
Wills righted a turned over chair and sat himself down on it.
Mark swept an area clean of socks and underwear and sat
down facing him.
Wills read from the PDA, "It seems a fuel cell exploded on her
boat, killing this Steve Mercer instantly. She was diving at the
time and literally bumped into his body. Uck!"
"And?" Mark demanded. His hopes were starting to rise from the
pit of despair they had been in for the past few days.
"Her boat was forty miles from shore when it happened. Woah!
She swam back to shore towing this guys body!"
Mark gave Wills an incredulous look, "She SWAM back?
TOWING a guy. Fecking hell Wills, how'd she manage that?"
"Says here she found some wreckage, put his body on it and
then used currents to drift back to shore. Oh yes, she'd put her
shark repellant canister inside this guy's body and sealed it in
with her wetsuit. This prevented her from being attacked as she
swam. "
Mark's face dropped.
"Hey, what's up?" Wills asked.
"She is way Way WAY out of my league. She's out of league for
anybody I know. I've spent some time diving and there is no way
in hell you do what she did unless you are one hundred and ten
percent sure that you are going to make it back. You know what
the real neat point is? She towed the guys body back! I'll say
that again she towed the guys body back!"
"Your point?" Wills asked. He was failing to see where Mark was
leading.
"Say that guy was average size and weighs about one ninety
pounds. That's an extra bodyweight you have to pull. Sure you'll
lose some when it's floating but still. Yet she was strong enough
to swim forty miles. After seeing this guy's body underwater she
doesn't panic or do anything stupid. She sets everything up,
works out what she is going to do, and then does it."
"Says here she walked out of the sea near a fishing village, As I
said sun burnt, exhausted but none the worse for wear."
"And another thing. Aircraft were searching for them. They
would follow the current as that's the way anything would drift so
why didn't they see her?"
Wills shrugged his shoulders "Dunno."
"SEE what I mean! She's fit enough to swim forty miles,
resourceful enough to survive in those conditions, cool headed
enough not to get attacked by sharks and she still has enough
consideration and forethought for the guy's family to bring his
body back. As I said, way, way out of my league."
"There's only one sure fire way to find out" Wills stated. He saw
what Mark had been driving at. This was one hell of a woman.
"How?" Mark asked.
"Wait until the Uber babe comes back in a couple of months."
-- o -- o -- o--
One Week Later
------------------------
Anne Baxter lay stretched out on her bed. Steve's funeral was a
little over a week away, and attending it was not a pleasant
thought. Why did everyone she remotely like or care for die on
her? Sure Steve may not have been husband material, but she
did get on well with him. She closed her eyes and tried to
access the part of her that could shut away the death of a close
friend. She tried to suppress how she felt about what had just
happened but found that the feelings of loss wouldn't go away.
Maybe she had been fonder of Steve than she had admitted to
herself. Maybe it was just the grief and shock making her feel
this way. She decided that a good compromise was that it was a
little bit of both.
She reflected back on her survival of the sinking of the "Anna
Maria". That had been a very stupid thing she'd done. The
proper thing to do would have been to wait for rescue at the site
of the wreck, not swim forty miles to shore just because she
could. The reaction of Steve's parents gave her some comfort.
She had done the right thing by returning his body to them. It
would make their grieving process a little easier, but what of her
grieving process? Was Steve just another death to add to her
list of those who had came in contact with her?
It was, she decided self-defeating to think like this. She and
Steve had performed some important work during their time
together and nothing could take that away from them. She did
feel a little guilty about lying to Steve's parents about Steve
coming up with the idea that could not only remove much of the
pollution from the world's oceans but also provide an almost
limitless supply of minerals. That had not been Steve's idea, it
had been hers. Where it came from didn't matter to her, as long
as it worked and she was as sure it would as she was that she
could make that forty mile swim.
The thought of the work she still had to do brought back
memories of the previous day's conversation with the dean of
Tel-Aviv University. He had given the usual platitudes of being
sorry and how Steve would be greatly missed.
Anne ran thru the conversation in her mind.
"So what you're saying is that I can't go out anymore but I have
to do the rest of my tenure here behind a desk?" Anne still felt
annoyed even a day after the event.
"Ms Baxter. We have no more research vessels free and no
vacancies on the ones we have. Until the insurance pays up
then we cannot afford to buy and refit a new boat and even if we
could, your time would be up before it was ready," The Dean
was most insistent.
Anne still refused to give up, "But this is important. We were so
close; even another week on board another ship would be
enough. We lost all our samples, all the genetic material
everything in the wreck. Steve managed to save all the work
we'd done to the off shore archive otherwise we'd be back to
square one. If you value his memory as much as you say you do
then you'll let me complete it for him."
"Do you want your Ph.D. or not? If you do then complete it back
on shore. Otherwise you are free to go back to your college right
now. You won't even tell the head of faculty what you were
working on, only that it's a certain Nobel Prize. So how do I
know that this isn't just some excuse for you to go diving some
more?"
Anne was getting exasperated. Why would no one trust her?
"I've told him as much as I can. It's to do with Plankton. Ok fine,
I'll work from shore but I'll make sure that this university gets
none of the credit for helping me avert the greatest
environmental disaster the world has ever seen since the
extinction of the dinosaurs!"
Anne smiled to herself. She had hit the Dean where it hurt, loss
of prestige and therefore money.
The Dean still wouldn't give in without a fight "Oh come on, Ms
Baxter you're exaggerating."
Anne raised an eyebrow in surprise, "Am I? Year on Year
decline in Plankton reproduction, year on year increase in birth
defects and sterility amongst the vertebrate and invertebrate
population, year on year decreases in plant and coral life. This is
all happening on a global scale. Within the next seventy to one
hundred years we are facing almost total extinction of all
complex life forms in all the world's oceans. Ask Dr Bayan, he'll
verify what I'm saying is true. He's looked over our data and is
right now getting ready to pitch to the UN to do something.
Because if the oceans die then we cannot and will not be far
behind. Now I will get my research done someway or another.
I'd rather it be here because all my notes and samples are here,
but I can just as easily go to Australia and get it done," Anne
had just left the threat hanging.
"And all you need is a week?"
"Maybe two," Anne had said.
"Ok you have your two weeks. Just make sure you're right about
this and damn sure this university gets a mention. You'll replace
Dr Quenby on board the "Esau" on Monday."
"Thank you, You won't regret it,"
Anne gave a self-satisfied yawn. Today was Sunday, and
tomorrow she would be back on board a ship; more importantly
she could get back to the verification of her hunch. She was
sure it would be met with uproar when it was announced but it
was the only way.
Her mind wandered back to Steve once more. He would have
been delighted at her result in front of the dean. It would be, she
decided, a fitting memorial to him if she was able to pull it off. His
death would not have been in vain and this thought made her
sorrow more bearable.
"Hi-fi, Track 6 personal collection."
The small box in the corner beeped in recognition and started to
play. Anne closed her eyes and listened to the haunting song.
'Flying over to the U V A
Easy rider, she could dream all day, dream all day
Yeah, she's heading all the way to the sun
Or far enough to get what she wants
Maybe she will, maybe she won't
It's easy to say, hard if you don't
Flying, gliding to a slow decay,
Now is nothing when it's yesterday,yesteday
Yeah, she's heading all the way to the sun
Or far enough to get what she wants
Maybe she will, maybe she won't
It's easy to say, hard if you don't
But you've got to make the most of today
For beauty dies young, beauty dies young
Yeah, she's heading all the way to the sun
Or far enough to get what she wants
Maybe she will, maybe she won't
It's easy to say, hard if you don't
But you've got to make the most of today
For beauty dies young
But you've got to make the most of today
For beauty dies young
You've got to make the most of today
For beauty dies young, beauty dies young
Beauty dies young'
-- o -- o -- o--
"I don't think this will fit me anymore," Matthew said jokingly,
pulling out a short nylon skirt.
"Nor this me," Kat joked back showing Matthew a pair of jeans
with a hole cut out in the rear. That pair of jeans had been made
for Kat when she was still living as the half tiger and half woman
creature that Dr Bexley had turned her into, and the hole had
been for her tail.
"Why'd we keep so much junk?" Matthew asked.
"Dunno. Elizabeth might like your old skirt though."
"Nahh, it's not got a designer label on it. God, I hated wearing
those things," Matthew stated.
"Not as much as I hated wearing those jeans," Now some
twenty years after they had been turned back into their 'proper'
forms they could now joke about it. Well almost.
"I've no idea how long I could've stood being a woman,"
Matthew said gently.
"As long as it took. Matthew, why'd we keep all of HER stuff
from her old house? She's not going to need it anymore," Kat
said.
They had stored all of Dr Bexley's personal belongings
from her old house just in case any of it would prove useful.
Now some twenty years later, the time had come to have a
spring clean. Besides, maybe clearing out Dr Bexley's old
belongings helped take their mind away from their own
daughter, so many miles away and so vulnerable.
Matthew shrugged his shoulders, "Seemed like a good idea at
the time I guess. Just as well we've got enough space to store it.
Y'know how it is stuff just kinda grows. It was your idea to have
a clear out anyway."
"Too right!" Kat suggested.
"I think we should auction it off. It'll make a bomb on E-Bay2, "
Matthew suggested.
"And have all those Children of Bexley freaks fawning all over
it? When Cathline next visits in a month or so we'll let her read
some of the journals. She's into that kinda thing." Kat said. The
last thing she wanted was to provide that cult with some more
'sacred' artifacts.
"Ok, We'll pile all of HER stuff in one corner. All her books,
clothes and stuff can go over there," Matthew pointed to a
corner of the room that was less cluttered than the rest. What
about our stuff?"
"Bin it I guess. It seems a shame to throw away all that history
but it IS in the past and we need the room. Put it in the opposite
corner to HER stuff," Kat suggested.
"Kat, I'm still worried about Elizabeth," Matthew said. He'd been
waiting for the right moment to voice his concern.
"Me too. We've done all we can to ensure that she turns out
alright. Now it's up to her," Kat said softly.
"You think we should tell her?" Matthew suggested.
"Nope. If she knew it would destroy her. It would ensure that she
really would fail the test. We have to trust her and ourselves."
"I'd hate to lose her," Matthew said sadly
"Me too," Kat said and gave Matthew a comforting hug. It had to
work out with Elizabeth -- it just had to.
"This is getting much too serious. Hey Kat, you think I'd look
sexy in this?" Matthew said pulling out a black silky teddy.
"Of course darling," Kat rummaged around for a while and then
spotted a small booklet. She fished it out and showed it to
Matthew. "You should have read this first, it might have helped."
Matthew read the cover of the booklet 'Yamaha GP1200 R
Jetski instructions and guidelines'. "Very funny. I can whip your
butt any day of the week."
Kat gave a smile. She had comprehensively beaten Matthew in
every Jetski race they'd ever had. All except one when she'd run
out of fuel. "Like hell you can."
"Wanna bet. I'll order some new ones up and we can resume
where we left off."
"Ok Let's finish clearing this up. Elizabeth will be back in a
month so you'd better order three. You'd better get used to
finishing last though," Kat smiled at Matthew.
"In case you haven't noticed I'm not a wussy girlie anymore."
"I certainly had," Kat gave Matthew a seductive smile and
moved in for the kiss. Matthew responded in kind and soon any
thoughts of clearing up were forgotten.
-- o -- o -- o --
"Elizabeth, That guy over there is still looking at you," Angela
hissed.
"That he may be, but I'm not interested," Elizabeth replied. The
guy was cute, real cute though. He was, she estimated, a clean
six foot, his short cropped blonde hair was neat and his blue
eyes took in her every detail.
As if reading her thoughts Angela said, "Look. He's the cutest
guy in the room. Go talk to him."
"No," Elizabeth said flatly.
"Don't turn round, but he's coming over," Angela whispered
Elizabeth froze. That's the last thing she wanted. Even if the guy
was cute. She heard the man's footsteps draw closer until he
pulled up a chair and spoke.
"I'm sorry for staring at you like that."
Elizabeth was a little taken aback, "That's ok." She muttered.
"Thanks, " The man said and stood up to leave.
"Hey," Elizabeth called. Nice ass Elizabeth thought.
The man turned around, "Yes?"
"Why were you staring at me? Don't give me any of this most
beautiful woman in the room crap either", Elizabeth said
forcefully. Her blue-gray eyes showing flashes of defiance.
"Bugger, That was my one good line gone," the man joked. His
English accent had a clipped BBC tone about it. It was strangely
alluring to Elizabeth.
Elizabeth nearly smiled back but stifled it down.
"If you must know I was wondering where you got your lipstick,
sorry, lip gloss from. I think it'd suit me." The man's face showed
amusement.
Now Elizabeth couldn't help but smile, "Actually I think you're
more a deep red kinda guy than this light plum. Blue eyes and
deep red definitely go together. I'll give you my stylists card if
you want," Elizabeth moved a hand towards her purse.
The man was a little taken aback, "Ok, Ok you win. My name's
Nick and you are?"
Didn't the man read magazines? Elizabeth thought, "Elizabeth."
"Elizabeth, nice name. Who's your friend?"
"Angela. Actually, Elizabeth here was telling me what a cute guy
you are", Angela said.
Elizabeth shot a soul piercing glare at Angela, but Angela
ignored her.
Nick caught Elizabeth's glare "Thanks. What are you going
tomorrow? I'm doing a study on how our best friends can be our
worst enemies and I'd like your input. Meet me by the river at
say eight?"
Elizabeth considered his offer. Angela wouldn't rest until she'd
set her up with some guy at least for one date. She decided that
Nick was at least a little amusing and seemed like a decent sort.
After all it was only one date. "Sure why not. I hope you'll use
real names to protect the guilty."
Nick gave a smile showing a perfect set of teeth, "Deal. Angela
you are in for it big time. Until tomorrow then,"
Elizabeth gave Nick a stunning smile, "Deal."
-- o -- o -- o --
Elizabeth had now been dating Nick for the past three weeks. The
first date had gone better than she expected, and in spite of her
initial reservations she found Nick fun to be with. He shared her
slightly off the wall sense of humor and was even quite a good
cook. Elizabeth had originally bawled Angela out over her overt
matchmaking but had now conceded that it was a good
thing. She had politely declined Nick's serious advances saying
that she preferred to wait. Nick was fine about this too.
Nick was studying cybernetics at the Gates College of advanced
technology. It was a subject Elizabeth found a little dull,
preferring the infinite and intricate possibilities of DNA and
medicine. Elizabeth had to admit that some of the theories and
hardware that were being mooted were seriously cool. Implants
in the brain that acted as additional memory, implants that
automatically translated any language into any other language
and enhanced replacement limbs that were just as or even more
dexterous than the real thing. If he weren't careful Nick would go
on for hours about it. Elizabeth would just sit there and listen
intently, studying his rugged face or contemplating how it was
that she was slowly but surely falling for him?
It was nearly the end of the semester and Elizabeth was
wondering what it would be like to leave Angela, Nick and all her
other friends behind for a month or so. She would miss them
and Angela had declined her invitation to visit her for a while.
Angela missed her parents too much even though they hadn't
visited all semester.
Elizabeth was sat in front of her PDA, reviewing her end of term
paper. Angela was out, at the library or doing something else.
Elizabeth had just read a complex DNA sequence when she
heard a knock at the door. She recognized the knock. It was
Nick!
Elizabeth shot up out of her chair and flung open the door.
Without waiting for Nick's greeting she flung her arms around
him and gave him a large hug. "Hi"
Elizabeth got a little worried when Nick didn't return the hug.
"Can I come in?" Nick said solemnly.
Elizabeth's heart was in her mouth. What could be wrong?
Normally Nick was outgoing and witty. It was those qualities
Elizabeth liked in him.
"You'd better sit down," Nick said softly.
Elizabeth did so, a feeling of dread was inside her.
Nick's face dropped "There's no easy way to say or do this so I'll
put it bluntly. Elizabeth, it's been real fun getting to know you.
Even better going out with you but I'm afraid I can't go out with
you any more."
Elizabeth felt liked she'd been hit with a lump hammer and
kicked in the gut at the same time, "Why? Is it me?"
Nick reached out and clasped Elizabeth's hand. She went to pull
away but Nick looked her in the eyes and she stopped. "Liz, it's
not you. Please don't ever think it's you. You're beautiful, witty,
far more intelligent than I am and I'm sure there's somebody out
there for you. It's just that, that someone isn't me."
Tears formed in Elizabeth eyes, "You didn't answer me", she
snapped.
"Hey I'm about to. We're in different worlds. You turn up to our
first date wearing that 50K outfit of yours, and I turn up wearing
my best pants and shirt costing all of 100 Euros. Next week
you're off to your own island while I go back to my parent's semi
in Basildon. How can it work Liz? I wanted to do this now before
it got serious and we both got hurt even more."
"I thought we were serious!" Elizabeth sobbed. Never had she
felt hurt like this before. Could nothing replace the empty space
inside her? The word she'd heard Angela use when she'd got a
low mark on an important test was 'gutted'. That was exactly
how she felt now. As though someone had ripped her heart out
and left it beating on the floor.
"Liz, please I still care deeply for you. But it wasn't just the gap
between us. Where were we going?"
Still crying Elizabeth managed to say, "I wanted a chance to
find out."
"Sorry Liz. I'm not some kinda dump and leave kinda guy. I
wanted this to work out as much as you did. But it wasn't to be."
Elizabeth gave Nick a glare that shook him to the core. It was a
glare of such venom and fury that he almost wilted under it, "I
think you'd better leave?"
Nick still a little shaken by the ferocity of Elizabeth's demeanor
stood up and turned to leave. His heart was pounding at the
sight of those blue-gray eyes boring into his soul. They were
almost demanding blood in return for the pain he'd just inflicted.
A fear crept through him until he fled from the room. What had he
just done?
He could still hear Elizabeth's sobbing as he slammed the door
shut more in fear than anger and made his way down the
corridor.
-- o -- o -- o --
Nick was still upset with breaking up with Elizabeth. He had tried
his best to make it as painless as he could for her but he felt as
though he had messed the whole thing up. She just hadn't
understood what he was trying to get at. He knew that she knew
that his reasons didn't hold water but how could he have told her
that there was someone else?
It was, he decided better that he lie to her rather than tell her the
truth. The real truth was that he had met someone a week or so
ago but couldn't face telling Elizabeth about her. She was
everything Elizabeth wasn't. She had a fire about her, she was
from a normal background not some celebrity rich kid, and
furthermore she didn't creep him out as Elizabeth had so often
done.
Yes, he decided he'd done the right thing. Elizabeth was one
scary woman. She could run rings around him on the
intelligence front, always seemed to know what he was going to
do before he did it, and as for that 'look' she gave him, it was right
from the depths of hell and fury. That didn't mean she wasn't fun
to be around or that she wasn't a nice person. She was. She
had compassion, wit, integrity and wisdom, but was also a little
aloof and austere.
Nick regretted the way in which he had had to break up with her.
Maybe he should have told her, but he knew that would hurt her
more in the long run. It was too late now. He just hoped that
Elizabeth would get over him and that she could move on. He
did feel a rat cheating on her like that but how often does true
love come along, once in a lifetime? He hoped that in the long
run Elizabeth would understand.
-- o -- o -- o --
Elizabeth had been inconsolable for three days. Angela had
tried all the tricks in the book to cheer her up, from ice cream to
slushy movies. Now with only two days to go before the end of
the semester it looked as though Angela would be leaving
Elizabeth just when she needed her the most. Angela's patience
was starting to wear a little thin with Elizabeth's introspective
moping. "Elizabeth, I hate to say this but get a life. Men are
bastards, we all know that."
"You get a life! I don't see you with many boyfriends!" Elizabeth
snarled, and gave Angela another one of her soul piercing
glares.
Elizabeth's comment stung Angela but she shrugged it off.
"That's because I'm too busy working and trying to pass my
course. At least Nick had the decency to try and be nice to you.
He tried to spare your feelings as much as he could."
"You don't believe his reasons he gave me? Because I don't!
Why did he lie to me?" Fresh tears formed in Elizabeth's eyes.
"I don't either. He probably met someone else and wanted to let
you down gently. He really cared about you Liz, but he's right,
sometimes it just doesn't work out. In the end one thing's always
there to bail us out."
"What's that?" Elizabeth said miserably.
Angela gave a smile, "Ice cream and chocolate. Yes I know
that's two but they are inseparable. What'd you say I walk into
town and get some chocolate fudge cream? We'll have a girls'
night in to celebrate surviving a whole three months with each
other."
Elizabeth liked the idea of that. Angela had been her rock during
her time here. She always seemed to know what would make
her feel better and was always someone to sound out at. She
hadn't regretted telling Angela her secret at all and, in fact
Angela knowing it had helped her start to come to terms with
losing Nick. Not that she wasn't still as mad as hell with him it's
just that Angela made you forget your anger for a while and that,
Elizabeth decided, was just what she needed, "Ok make sure it's
the good stuff. This is a three tub situation. Oh yes, could you
pick up my medicine again for us. I just don't seem to be in the
mood right now," Elizabeth managed a smile.
"Oh at least a three tub. I'll buy four just in case. Your
prescription's in the usual place right?" Angela smiled, picked
her purse up and walked out.
Elizabeth stretched her long legs out over the sofa and reclined
to think. It had been a very long three months and in spite of the
work, which she had found ridiculously easy; she had enjoyed it.
The early couple of weeks had been freaky, the memories of the
Children of Bexley rally were still fresh, as where the feelings
related to that event. Part of her still felt elated at being
worshipped like that. This feeling was dimmed by her anger at
the baseless way they accused her parents of defrauding Dr
Bexley.
She was pleased to be able to help Angela out with her studies.
It had repaid at least in part the help Angela had been to her.
Angela was clever but really had to work hard to get the good
grades she needed. In spite of her coaching Angela never
seemed to be able to get to grips with 'thinking in permutations'
but that too was fine with her. Elizabeth had missed her parents
and even Auntie Cathline hadn't visited since that first trip when
she'd just moved in. She knew that this was a deliberate
strategy by her parents but that didn't matter. She knew they
loved her and that they were' doing what they felt was right for
her. She was a little sad that Alex hadn't been able to come.
She missed their verbal sparring and the annoying way he
called her 'kiddo'. No doubt Alex would visit sometime over the
vacation, and some old scores would be settled and some
new ones created. She checked her watch fifteen minutes had
just flown by. Her train of thought was broken by a sharp series
of knocks at the door. Wearily she stood up and answered it.
"Hello Ms Stephens," A silky smooth voice said.
Elizabeth nearly jumped at the sight of James Adams. Leader of
the Children of Bexley cult. He had dressed in a sharp Armani
suit with impeccable tie and shirt. His hair was neatly trimmed
and his eyes showed a look of friendly concern.
"Fuck off!" Elizabeth snarled.
"I came to apologize. Please let me come in. I promise no tricks,
no worship, no anything, just apologies." James said in a
comforting tone.
"Say what you have to say and then go. PDA Set instant alarm,
usual parameters." Elizabeth called.
James heard Elizabeth's PDA beep signaling that the police
would be called the moment Elizabeth desired. That didn't
bother James. He hadn't come here to make trouble.
"Thank you, " James said and pushed past Elizabeth and sat
down on the sofa where Elizabeth had just been laying.
"Ok what do want?" Elizabeth said, folding her arms in defiance.
"I wanted to say I'm sorry about what happened at the meeting a
few months back. It's taken me a while to track you down but
you must know all that worship stuff wasn't my doing. Sure I feel
as though Dr Bexley had a great deal to teach us but she was
not God." James's voice was soft and placating.
Elizabeth unfolded her arms but moved towards the door "It
wasn't the worship stuff that bothered me. It was the lies about
mom and dad. I don't hear you saying you're sorry about them."
"Ms Stephens, Elizabeth. In our lives our judgement is clouded
by our environment, who we are and what we do all affect the
way we look at things. By all accounts you have a brilliant mind.
Have you ever turned it to looking at the facts surrounding Dr
Bexley and your dad's involvement in her life?"
"I don't need to. I've seen the evidence," Elizabeth snapped.
"Only the evidence that you yourself have chosen to believe. If
you would take a fresh look thru the dispassionate eyes of
science you would see a lot of the evidence you have been
shown doesn't hold water. What I'm about to show you is top
secret. It's been in my possession for a number of years but I
want to show it you in order to make my point."
"You're not going to convert ME! Elizabeth snapped.
"I'm not wanting to convert you. Just free your mind to other
possibilities." James pulled out a plastic bag from his inside
pocket, "What's this?" he asked, showing it to Elizabeth.
"It's a receipt dated 15th July 1997," Elizabeth said.
"What's it for?"
"Cosmetic alteration of a woman called Jane Andrews the sum
total is fifty two thousand dollars," Elizabeth said suspiciously.
"Can you outline the work performed by the clinic. In lay terms
please?" James asked.
"Breast, hip and face alteration. Body sculpting and fat re-
distribution and hair transplants. In my opinion this Jane
Andrews was given a whole new look from head to toe. She was
remade as someone else," Elizabeth stated.
"Whose is the signature on the bottom of the receipt?" James
asked. His voice a flat tone, like a lawyer in a court case.
"It's a little hard to make out but it looks like dads," Elizabeth
voice tailed off as the realization hit her.
"That's right. Jane Andrews is your mother's maiden name and
the signature at the bottom of the receipt is your dad's. On the
15th of July 1997 he paid Jane fifty grand to become another
woman. If you look at the specification of the work done it fits in
exactly with Dr Elizabeth Bexley's vital stats. Why would he do
that if not to create some outlandish story about DNA altering?"
Elizabeth stared at the receipt," This, this is a lie. It's a fake,"
She started to blink back tears.
James voice lowered to a comforting tone, "It's no fake. I've had
it analyzed by the MIT genetics lab. You can check with them if
you like. The fingerprints and DNA fragments match that of your
father. He did sign this, the work was performed and I'm afraid
to say that we have all been lied to. All the time this whole Fury
thing was a hoax. Why was there no trial in order to ascertain
who should get Dr Bexley's money after she vanished?
Elizabeth, listen to me. Do your own research with an open mind
and you'll see that I'm right."
Elizabeth started to sob. It couldn't be true. It was all a trick. It
had to be. Her parents were not like that, they would never ever
do anything like that. Make up a story, kill and discredit for
money, never!
James put a comforting hand on Elizabeth's "I know it's hard
and I know you don't trust me I wouldn't if I were in your place.
All I want you to do your own reading and reach your own
conclusions."
"Why'd you tell me this?" Elizabeth sniffed.
"Because I want you to know the truth. I know you're not really a
copy of your dad because DNA altering technology doesn't
exist."
Elizabeth gave James a defiant glare, as if to say 'so prove
it doesn't!'
James ignored the glare and continued "Before she died Dr Elizabeth
Bexley cloned you from her own DNA. That much is possible. There is
no other explanation for how you look or how you are. You owe it to
yourself and to your mother to find out the truth and let that truth
be known. You are her legacy to us."
Elizabeth tried her hardest to subdue the look of shock she felt.
THEY KNEW! How in hell could they know about her true
origins? What were they going to do with that information? Did
they want her to join them or at least acknowledge that they had
some valid points to make? Indeed James did make some valid
points and she would ask dad about that receipt when she got
back. What if what she had been told was a lie? Where would
that leave her? Did she have a greater loyalty to the truth or to
her parents?
"I see that you knew you are Dr Elizabeth Bexley's daughter
already. Don't worry, we're not going to do anything that will
harm you or the ones you love. You parents have portrayed us
as the bad guys but they couldn't be more wrong. Even though
you may not believe us we do care about you Elizabeth, we
really do. We don't want to see you hurt or lied to. As Dr
Bexley's heir you are a precious jewel to us. Look, I've said
enough I can see you are in turmoil over this. Please speak to
your mom and dad. Ask the questions you know you want
answers to. Use that exceptional brain of yours to find out what
really went on twenty years ago," James voice had a soothing
tone to it and Elizabeth began to feel a little better.
"I still don't," Elizabeth started to say. Her mind was in turmoil.
Her whole life had been built around what had happened before.
Her whole view of herself as a potential time bomb had been
colored by these events, and now this man sitting in front of her
was telling her otherwise.
James read what she was thinking "That's right Elizabeth.
You've spent all your life afraid of what you might become and
now you're starting to realize that you have nothing to be afraid
of. Since you first knew who you were you've lived in fear, fear
of what you might do if you trusted and fear of what you might
do if you loved. That's a terrible burden for anybody let alone
someone like you. You needn't feel that anymore. If you
embrace the truth then it will set you free."
Maybe James was right. She had spent her whole life in fear
and self-loathing. The burden had been a hard one. Elizabeth
was so tempted to believe what James had to say. To be free of
the specter of the 'hell bitch' was alluring. But the price she
would have to pay would be too much, "I can't betray my
parents," Elizabeth said softly.
James shook his head, "I'm not asking you to. All I'm saying is
believe that Dr Bexley wasn't the monster the world made out.
Are you a monster?"
"No, " Elizabeth almost whispered.
"I believe you. Why don't you believe yourself? It's because
you've not sought the truth."
"What is the truth?" James's faultless logic, comforting voice
and wisdom had worn down Elizabeth initial resentment.
James looked Elizabeth in the eyes and said in a voice much
like her fathers when he wanted to comfort her, "The truth is. Is
that Dr Elizabeth Anne Bexley was not the monster the world
has portrayed her as. She was compassionate, gentle and kind.
I've spoken to those who knew her. They all say she was kind in
spirit, funny and full of life. She committed suicide so that your
Mom and dad could live in peace. She knew that no matter what
she did the world would always remember her as a manipulating
serial killer and that nothing she did to disprove it would matter.
It was better she die than try and live disproving a lie that the
whole world believed. Elizabeth you are so like her. I can see in
you the potential she had but was forced to throw away. If you
tell me to go and leave you alone I promise I will never return. I'll
leave you in peace but please, please look beyond what you
have been told. Look into yourself. Could you ever kill anyone?"
Elizabeth's shook her head, "No I couldn't. I did a study on HER
once. You are right, she was a lot like me. I think it's time you
left. I will do as you say, just for completeness. It's best to look
at both sides before reaching a decision. Can I have that
receipt?"
"Sorry no. But here's a copy. I've sent you the lab reports from
MIT as well" James said, reaching into his pocket and handing
Elizabeth a slip of paper.
At that moment Angela walked in holding a bag of shopping.
She took one look at James and screamed, "Get the FUCK out
of here!"
"It's ok I was just leaving." James said, rising to his feet.
"Elizabeth what the fuck is HE doing here. What's he been
telling you?" Angela demanded.
"He came here to apologize," Elizabeth stated defiantly.
"I must be off. Thank you for your time Elizabeth, "James said
and strode past Angela and out of the door.
Angela turned to face Elizabeth once more, "What exactly did
he tell you?" She demanded.
"He came to apologize to me and then asked me to look at the
evidence surrounding the fury with a scientific mind. Ignore what
I'd been told and see for myself."
"And you told him to go shaft himself right?"
Elizabeth shook her head, "He made some valid points. I was as
surprised as you are."
Elizabeth then outlined her conversation with James.
"I must admit that receipt, if it is valid is mighty suspicious. You'll
have to let me know what you find. I know we'll work on it
together," Angela said.
Elizabeth was relieved that Angela had offered to help. She
would be her backup in case things went awry. She couldn't get
out her mind what James had just said. 'That's right Elizabeth.
You've spent all your life afraid of what you might become and
now you're starting to realize that you have nothing to be afraid
of. Since you first knew who you were you've lived in fear, fear
of what you might do if you trusted and fear of what you might to
if you loved. That's a terrible burden for anybody let alone
someone like you. You needn't feel that anymore. If you
embrace the truth it will set you free.'
Above all that's all she wanted, to be free.
-- o -- o -- o --
Anne Baxter sat down on the sun lounger by her pool. She had
treated herself to a few days 'R and R' after a hectic couple of
weeks on board the "Esau". There had been some resentment
at her replacing Dr Quenby on such short notice but she had
soon earned the respect of the crew and researchers. The
'Esau' was an older design having diesel engines instead of the
more efficient fuel cells. It also lacked re-breathers, which meant
she had to spent more time in decompression and limit the
amount of time she could spend underwater. None of this
mattered to her now. Her idea had worked, the theory was
sound and the data gave incontrovertible proof of it. Now all she
needed was a way to scale it up several million fold without
damaging the ecosystems she was trying to save.
She hadn't shared her findings with anyone yet, knowing that if
the idea were exposed early then the political and scientific
backlash would be considerable. Her only choice was to go for
industrial backing, which ironically was one of the very things
that were causing the destruction of the worlds oceans. It would
take years and millions of dollars to develop the process fully
and safely but at end of it the result would be almost limitless
raw materials. Within a hundred years the world would have an
oceanic ecosystem that was back the way it was several
hundred years ago.
Anne felt as though she deserved a few days off. Her tenure still
had two months to go but she already knew exactly what she
needed to do. The rest of the two months would be spent in
writing up her findings and proposals so she could publish them
when the time came. Of course the world would think them as
Steve's idea with her carrying on his work. She didn't mind this
one bit. It was her ocean she was protecting, not her reputation.
Thinking about Steve brought back memories of his funeral. As
she had promised she had attended even though she knew
nobody there. She had been asked to say a few words and so
she had said the usual platitudes, which seemed to go down
well with all the mourning relatives. As a mark of respect she
had placed a single red rose in his grave and then slowly
backed away. She had flown back the next day, after a stop
over in New York to visit her own parent's graves before
returning to Tel Aviv.
She thought back to the results of the tests she had performed.
The plankton had responded even better than she had
imagined. Anne was feeling not a little smug and satisfied. It's
not everyday you develop something that could save millions.
Anne decided to celebrate a little. It had been too long since
she'd indulged herself. Far too long and what the hell!
"PDA get room service to order me another bottle of
Champagne. The Bollinger 18 will do. Oh and play track 8
personal collection."
Anne put the ear piece to her ear sat back and listened to the
instrumental music track. A big smile was all over her face.
It was good to be back.
-- o -- o -- o --
Elizabeth stood on the bow of the boat watching the sunset over
the Maldives. She never tired of the view, the infinite variations
of red, orange and yellow reflected on a turquoise sea. Today's
sunset was a deep blood red with flecks of orange fire scattered
at random throughout the sky. Elizabeth was extremely tried
from the journey. A twelve hour flight from London to Male,
followed by a four hour boat trip to her parent's island. She had
been too late to take a chopper over and hadn't thought to
charter one in advance. Actually she preferred the boat trip. It
gave her time to clear her mind and to reflect upon what she
wanted to ask and what she wanted to do.
The conversation with James, the cult leader had disturbed her
more than she had first thought. Coming so soon after her
breakup with Nick it had left her feeling as though she had been
stretched in all directions at once. She had read the notes the
cult leader had given her on the way over and had to admit they
did make a certain degree of sense. She resolved to make it her
business to find out but first she would unwind. She knew from
her parents Email that Cathline and Alex would be there too. It
would be the perfect forum in which to mount her investigations.
She was still worried about what she would do with the
information she uncovered if it showed what James had told it
would. Would or even could she disclose her findings? No she
decided she wouldn't. This was to be for her benefit only.
Elizabeth wished Angela were here. She had so wanted to
share with her the world in which she lived. Sure the island had
pools, gyms, tennis courts and everything that an exotic resort
needed but to her it was just 'home'. She checked her watch
there was still over an hour to go. Elizabeth fished out her new
PDA. She had spent the remainder of her allowance on
upgrading it to the latest Sony-Micro-Sun model. Its shiny silver
metallic case glinted in the sunlight. She thought Nick would like
it, but then remembered that Nick was no longer part of her life.
This brought another twinge of sadness as she remembered the
fun Nick and her had had. Still clutching her PDA she walked to
a nearby chair and sat down.
"PDA open up a video channel with mom and dad," she said.
The PDA bleeped a few times and eventually Kat's face
appeared on the small plasma screen. On seeing Elizabeth her
face broke into a wide smile.
"Hi Mom. I'm on the boat coming over. I've got about an hour
before they drop me off,"
"Elizabeth! It's great to see you. We've missed you so much.
Hey, I didn't know they had a vid-phone on that ramshackle
thing," Kat.
"Dad'll love this. It's my new PDA. It's got a built in satellite vid-
phone. It is shall we say well cool. Has Cathline and Alex arrived
yet?"
Kat's face nodded, "They arrived last night. It's so nice to have
every one back together again. I've sent the servants away for
the holiday so it's just us for a change. I'd better go this must be
costing you a fortune."
"Bye mom. See you in an hour or so," Elizabeth gave Kat a
smile and ended the call. How could anyone remotely think that
her mom was involved in grand theft and murder? No way!
Elizabeth decided that she needed to take her mind off things a
little. Things were getting a little too stressed in her life at the
moment. Pressure had been building up inside her since she'd
first got to Cambridge and she had hoped that her few weeks at
home would enable her to relax a little. Her little conversation
with James had ruined that idea. She considered the option that
his visit was timed in order to achieve this. But what did he have
to gain by ruining her vacation?
Not a lot Elizabeth had decided. He was definitely up to
something, that much was certain but what? He did make a few
very good points. Dr Bexley was not the monster she was
portrayed as. She had come thru in the end to resolve one of
the twentieth century's closet calls with war. She really did have
nothing to fear from her. Being like her should be a source of
pride not of shame. James had been right in that much anyway.
Too much fear, loathing and distrust had been heaped on Dr
Elizabeth Bexley and Elizabeth decided that she was guilty of
that as well. The best way for her to find out what really
happened all those years ago would be to try and get inside the
mind of Dr Bexley. It was something only she could do and
maybe that's what James was after in her. Somebody who could
get inside the way she thought and operated in order to
ascertain the facts. Until her investigations were over she would
have to act, think and behave like Dr Bexley. No other way
would give her the insight into whether she could have done
what she was supposed to have done. It would be a simulation,
where she could play out scenario's in her mind do see if they
fitted in with what she knew. A role play with a serious purpose
in mind, to once and for all silence the critics.
It could not be a true simulation as she still took her Olanzapine
and hadn't had the trauma of being jilted like Dr Bexley had. Did
that matter?
Well yes it did. The whole jilting event had led to events in the
supposed fury and without that trauma it was very likely that Dr
Bexley would have gone on to lead a normal life. In order to
perform the simulation properly she would have to stop taking
her Olanzapine and generate a traumatic event. The hurt and
pain of being dumped by Nick was still very much there. Would
that be enough?
This idea worried Elizabeth. She could see herself getting
sucked into Dr Bexley's thought patterns and not getting out
again. She needed another safety net, somebody who knew her
well enough to know when she was over stepping the mark. Her
parents and Cathline wouldn't do. They would have a hissy fit if
they found out. Angela was too far away and Elizabeth expected
that she'd have the simulation run by the time she returned to
Cambridge. That only left Alex. Alex was the perfect choice, he
would know when she was taking it too far and in spite of his
annoying big brother act he could be trusted. Yes, that would
work. Alex would be her safety net.
Elizabeth put all thoughts of the task in hand and set about
finishing the configuration of her new PDA. The interface was
still as standard -- she liked to be able view multiple panes of
information at the same time. It took far too long to look at things
one at a time. She pressed a small depression in the side of the
PDA and extracted the small pencil sized wand. This was by far
the quickest way to draw out exactly how she wanted things to
be. She did wonder what Dr Bexley would have thought of it.
No, she told herself; from the time she stopped taking the
Olanzapine and setting things up with Alex she WAS Dr Bexley.
Nothing else would work. With that in mind she drew eight small
boxes on the screen of the PDA. Each one would act as a
separate or virtual PDA and have all the functionality of the main
one. Her interface configuration completed it was now time to
test it. It had been a while since she had used her brain to it's
full capacity, now it was work out time.
"VPDA1 search and display all personality profile and
biographical data on Dr Elizabeth Anne Bexley. Born 1969, died
2001," the top right screen issued a "searching" message.
Elizabeth had already set in her mind the information she
required.
"VPDA2 search and display all evidence pertaining to the
creation of the so called DNA altering compound created by
TGen corp in 1997. Also give complete details on the activities
of TGen corp during Dr Elizabeth Bexley's tenure there.
"VPDA3 search and display all testimonies and evidence both
written and aud-vid given in the two Bexley trials.
"VPDA4 search and display personality profiles and biographies
of Matthew and Jane Stephens. Cathline and John, Richards,
Robert Abbey, Robin Abbey, Vickie Turner, Stephanie Lane,
Salah, Detective Scott Harris NYPD, Detective Tina Cox NYPD
and Senator Walter Jameson.
"VPDA5 search and display all guild records pertaining to the
provision and use of genetic weapons. Include Guild records on
Tel-Aviv."
VPDA6 search and display all UN, governmental and
international records on the state of DNA research from the
years 1991 to 1997. Include theoretical information as well.
VPDA7 search and display all known information on the cult
known as 'The Children Of Bexley'
VPDA8 "Cross reference information from VPDA's 1 thru 7 and
display commonalties and inconsistencies. Also give suggested
conclusions to inconsistencies. Zoom out to max pane size
when complete."
Elizabeth completed giving her PDA instructions. The poor thing
would be working flat out for the few hours. She was sure that
people had done similar searches at one time or another but
she had an advantage she had access to the raw data. She
closed her eyes and in her minds eye started to form a model of
the connections she knew were valid. Possibilities and
permutations danced in front of her as she mentally linked them
together. The output of these links she formed into new
connections until it formed a three dimensional model in her
mind. She knew this wasn't the real thing, she still had
incomplete information but it would suffice as a rough draft. She
didn't expect to complete the model first time off; that would take
several days as Dr Bexley. But when it was complete she would
know her late mother better than anyone ever did and
furthermore be able to put to rest any doubts she had about her
parent's motives and methods. Another byproduct would be that
it would finally end her fears and enable her to be more open
and trusting. In short it was the only way she could see that she
could grow as a person. She concentrated a little more and in
her mind the model span into greater clarity
Elizabeth was so wrapped up in her thoughts that she hardly
noticed the boat dock at her parent's Jetty. It wasn't until she felt
the slight bump as the boat drew up alongside that she mentally
filed away her simulation and open her eyes. Naturally all the
family was at the quayside. Matthew holding Kat's hand, her
brother John standing alongside him. Cathline and Alex were
there too waiting for her to come ashore. On seeing them she
gave a smile and a vigorous wave and went down below to
collect her cases.
A few minutes later Kat was embracing her and she felt a sigh of
relief, she was home.
-- o -- o -- o --
Kat had made Elizabeth's favorite for dinner, Cajun Chicken
salad and as usual it was more than up to standard. Elizabeth
was ravenous after the trip and ate without speaking a word.
Elizabeth decided she missed home cooking, especially Cajun
Chicken salad.
"It's nice to have everyone back together again," Matthew
commented.
"Hey Kiddo. I'm sorry I didn't get to see you more, but I had
other things to do, " Alex said.
Elizabeth was surprised, no insult from Alex. This was a first.
"That's Ok I missed you too. What do you actually do for a living
Alex?" she jibed.
Alex gave a grin, "That's for me to know and you to find out."
"Cathline, oh before I forget we had a tidy up of all HER and
our old stuff. You want any of it before we burn it?" Kat asked.
Elizabeth nearly choked on her chicken. She needed that stuff.
Was there anything she could say that would allow her to have it
without arousing the 'why do you want it?' question. She
decided to wait until Cathline answered.
"I dunno Kat. It'd take me months to go thru it. I think I've said
everything that needs to be said," Cathline replied thoughtfully.
"I'll help you," Elizabeth blurted. Actually this was more like a
considered response. She had toned it in precisely the right way
to give the 'I want to help but I don't really mind either way'
inflection.
Cathline considered Elizabeth's request "Ok Liz, you can have
first look. Let me know if you find anything of interest. See if you
can find anything of note in HER old journals. She kept
everything, even her blank notebooks, clothes the lot. She was
nothing if not thorough,"
Elizabeth's heart leapt. 'yes'. "Thanks Cathline. I would be able
to spend a lot of time on it but I'll have a go."
-- o -- o -- o --
Elizabeth awoke the next morning and out of force of habit
reached over to take her Olanzapine. She had the glass of
water in her hand ready to swallow the small white pill in her
mouth when she remembered that she wasn't going to take it
anymore until her research was completed. In order to allay any
suspicion she placed the glass of water on the bedside table
and crushed the pill to a powder. She then drank a small
amount of the water in order to make her mom think she'd taken
it. How would she feel after the cumulative effects of the
Olanzapine wore off? Would she suffer any kind of withdrawal
symptoms? Her reading had indicated not but everyone's
physiology was different. Would she be able to perform those
amazing leaps of logic and intelligence that Dr Bexley had been
able to do? From her previous research on the fury, not taking
Stelazine had allowed Dr Bexley to produce some stunning
discoveries. The closer Dr Bexley came to insanity the more
devious, intelligent and vicious she became. Elizabeth hoped
that she could control those tendencies, and if she couldn't there
was always Alex to bail her out.
By now her PDA should have produced all the results from her
searches, so she pulled open the drawer in the bedside table,
retrieved her PDA and sat down to read. As she had ordered
VPDA 8 had maximized its display pane and had a list of
inconstancies based on all her other searches.
'1. The energy required to perform any kind of DNA
transformation would result in an extreme exothermic reaction.
The subject would literally burn up. Conclusion, DNA
modification as suggested by the late Dr Elizabeth Anne Bexley
is virtually impossible with current techniques.
2. If the subject's brain were left intact there is a strong
possibility of tissue rejection thus causing an almost certain fatal
reaction within the subject's body. Conclusion, DNA modification
as suggested by the late Dr Elizabeth Anne Bexley is virtually
impossible with current techniques.
3. Every other paper postulating on DNA modification stated that
modification of the genetic code was impossible once cell
multiplication had occurred. Conclusion DNA modification as
suggested by the late Dr Elizabeth Anne Bexley goes against all
current thinking and current techniques.
4. Cosmetic alteration could provide an identical copy of a
person so long as the right subject is chosen. Conclusion, total
body remolding is only possible by using surgical methods.
5. DNA testing as performed in the late 1990's was not infallible.
Conclusion, DNA testing is not a foolproof method of
determining identity.
6. No full copy of the human Genome was published until 2001.
Conclusion, TGEN had only produced a working draft when they
announced completion of the human genome project. The draft
was not enough to be able to control human DNA to the extent
proposed.
7. No analysis of the agent used on Tel-Aviv is available.
However significant damage to metallic structures was reported
in some areas. Fire damage made complete analysis difficult at
the time. Conclusion, Inconclusive information on the agent
used on Tel-Aviv. Possibility of genetic warhead use is
postulated to be less than thirty percent.
8. Records pertaining to the 'fury' are based on personal
recollection and events. No testimony from Dr Elizabeth Anne
Bexley was ever obtained. Conclusion, in order to fully verify
findings more information is required.
9. Even allowing for psychotic behavior, Dr Elizabeth Bexley's
personality profile prior to the fury does not match that of the
actions attributed to her. Conclusion, the actions attributed to Dr
Elizabeth Bexley were carried out by person/s unknown.
However, there is a small possibility of extreme personality
disorder in Dr Elizabeth Bexley. Probability of former conclusion,
greater than eighty percent.
10. Governmental and UN restrictions on data pertaining to
genetic modification are classified. No further analysis is
possible.'
11. Records pertaining to persons mentioned in VPDA4 are
classified. No information available.
Elizabeth skipped to the bottom of the pane.
'Overall Conclusions
Probability of DNA Modification 2%
Probability of DNA Warhead use on
Tel-Aviv 30%
Probability of accurate testimony 40%
Probability of Dr Elizabeth Anne Bexley
initiating the events in fury 20%'
Elizabeth gave a low whistle. The numbers didn't look good.
However the PDA's probability figures were based on processed
information. They were only as good the information it had found
and been given. She would need to start her simulation soon.
She changed her mind about telling Alex of her plan. If he said
something to her about her behavior then she would know
something was up. Telling him would only bias his opinion. She
refused to believe the PDA figures. No way could they be that
low could they?
Elizabeth swung her long legs out of the bed and looked out of
the window. The sun had just finished rising and the heat of the
day was starting to rise. Elizabeth took off her nightdress and
stepped into her shower. Soon warm soapy water was
cascading over her body and Elizabeth felt herself relax.
After this quick wake up shower Elizabeth changed into her
shark skin bikini and went for her now traditional morning swim.
Dr Bexley had been fastidious to the point of obsession about
her fitness and reportedly spent many hours a day either in the
pool or in the gym. Elizabeth decided that she would gradually
work up to the same routine. She found pushing her body to it's
limits helped clear her thoughts.
An hour or so later Alex found her, still doing lengths in the
Olympic sized pool. "You still at it?" he commented.
Not wishing to break up her routine Elizabeth ignored him. If he
wanted to talk to her he'd have to jog alongside.
"Be like that then. I only came to see if you were ok," Alex said
grumpily.
Performing a flawless turn Elizabeth set off towards the other
end of the pool. Should she start work now or wait until
tomorrow when she was sure the effects of the Olanzapine had
worn off? She could wait but then there was still a lot of sorting
to be done and that didn't need her in 'Bexley mode.' Alex had
caught her up and was saying "Are you OK? You're pushing
yourself too hard?"
"I'm ok. I'm out of shape," Elizabeth managed to say before
submerging for a prolonged underwater period. She would try
and swim the whole length underwater.
"Ok you just seem to be more serious than you used to be. Oh
well I'm off to watch Matthew and Kat race each other round the
island," Alex mentioned, and walked off.
You'd be serious if you didn't know who you were, if your
parents had been keeping something from you and whether
your real mom was the monster people thought she was, she
thought to herself.
Elizabeth swam for a further hour until she felt as though she
couldn't swim another stroke. Dr Bexley was WAY fitter than she
was. Did that matter? Probably not, as Dr Bexley said she
needed all her strength to cope with the demands of changing
her body. Still it gave an indication of how far she still had to go.
After drying herself off she made herself a quick bowl of museli
and ate it ravenously before making her way into one of the
spare rooms.
Matthew and Kat was right, they had cleared it up.
Before she left this room was piled high with twenty years worth
of rubbish. Now it was all in neat piles with yellow 'stickit' notes
on each pile. The room had a major division with Matthew and
Kat stuff on one side and Dr Bexley's on the other. Naturally
she headed straight towards Dr Bexley's pile.
One thing caught her attention. A large mahogany chest with
EAB engraved on the lid. Elizabeth raised an eyebrow, real
Mahogany. The chest alone would be worth thousands now.
She sprang it open to reveal clothes all neatly folded into types.
She picked up a short, reddish blue skirt. It was way out of
fashion now but was still passable as clothing. Elizabeth was a
little overawed 'SHE wore this. My real mother wore this' she
thought. 'What were you thinking and doing when you last wore
this?' Elizabeth tried to imagine Dr Bexley wearing it. She took a
quick look around and checking no one was looking slipped the
skirt over her already dry bikini briefs. 'Of course it fits' she
thought. Already she felt a connection with her late mother,
'strange how a simple object can evoke so much feeling.'
Elizabeth rummaged around in the chest until she found a
matching white blouse. 'Would SHE have matched this with
this?' Elizabeth wondered. Once again checking that the coast
was clear Elizabeth put the blouse on over her Bikini top. Some
more rummaging revealed matching shoes, a bra and some
pantyhose. Elizabeth drew the curtains and got dressed
properly, putting on Dr Bexley's old bra, skirt, blouse, pantyhose,
panties and shoes. She dug around a little bit further and found
a shiny plastic disk in a transparent plastic case. 'Hmm this is a
CD. How am I going to play this?" Elizabeth thought. She turned
the case over and saw a series of song titles handwritten on the
back of the jewel case.
Elizabeth sought out a mirror in the room but found none within
easy reach. She felt excited as though she was embarking on
something forbidden, dangerous and downright stupid. She
quickly ran from the room back to her bedroom, slammed the
door shut and stood in front of the mirror.
The likeness to the pictures of Dr Bexley was uncanny. Sure her
hair was shorter but her face, how the clothes looked on her and
everything was identical. That fact didn't bother Elizabeth -- of
course she would look the same. What did bother her was how
her face looked in the mirror. It had lost the soft fun loving lines
of the girl who'd left here a few months back, and now the eyes
looking back at her had a sad, haunted look about them. Her
face too had got harder looking, as Angela had told her. She
had lost the look of innocence about her. Strangely this didn't
bother her as much as she thought it would, as Kat had said she
needed to grow up and find her own place.
Elizabeth posed a few times in front of the mirror. Dr Bexley's
clothes did really suit her. Maybe it was the clothes that made
her look a little harder. The pain of losing Nick still riled her -- at
least he could've told her the truth. She'd read that Dr Bexley
had often listened to music while she worked. Elizabeth walked
to where she'd placed the CD and chose the first track on the
case.
"Hi-Fi, download and play 'The Queen Of Hollywood' by the
Corrs'," her stereo beeped a confirmation and started to play
"She drove a long way through the night
From an urban neighborhood
She left her mother in a fight
For a dream misunderstood
And her friends they talk on corners
They could never comprehend
But there was always something different
In the way she held a stare
And the pictures that she painted
Were of glamour and of flair
And her boyfriend though he loved her
Knew he couldn't quite fulfill
He could never meet her there
She's never gonna be like the one before
She read it in her stars that there's something more
No matter what it takes no matter how she breaks
She'll be the Queen of Hollywood
And the cynics they will wonder
What's the difference with this dream
And the dreams of countless others
All believing in TV
They see their hand prints in a sidewalk
Flashing cameras on the scene
And a shining limousine
She's never gonna be like the one before
She read it in her stars that there's something more
No matter what it takes no matter how she breaks
She'll be the Queen of Hollywood
She's believing in a dream
It's a loaded fantasy
Now her mother collects cut-outs
And the pictures make her smile
But if she saw behind the curtains
It could only make her cry
She's got hand prints on her body
Sad moonbeams in her eyes
not so innocent a child."
"Hi-Fi, stop play," Elizabeth said. This was getting scary. The
song outlined exactly what she felt. She had lived with the
'Hollywood' lifestyle all her life. Lived with being the appropriate
term. There were few occasions when she could have honestly
said that she had enjoyed it. In fact, in spite of Nick her time at
Cambridge had been one of the happiest of her life. Break time
was over. It was time to see what else was in the junk room.
-- o -- o -- o --
Cathline had just walked back from the jetty, leaving a still
squabbling Matthew and Kat there. The Jetski race had been
bitterly fought and much to Matthew's chagrin Kat had
triumphed in all six races. She wasn't unduly worried about them
arguing. It was all very good natured, but those two did seem to
take it especially seriously. She had made her way back to the
house to get some more water. Apparently it was her turn to
race Matthew next -- she would of course let him win as his ego
had been bruised enough. John and Alex had taken the yacht
back to Male to get some fresh supplies so they would be gone
several hours. Cathline opened the door of the house and
walked into the marble floored hallway. In the corner of her eye
she detected movement from one of the upstairs walkways. A
figure in a white blouse, reddish blue skirt and auburn hair had
just shot into a spare room.
'I wonder what Elizabeth is up to?' Cathline thought. She hadn't
ever recalled seeing Elizabeth wearing such clothes. Normally
Elizabeth was very fashion conscious and from what she'd just
glimpsed her clothes were at least twenty years out of date.
Cathline walked up the stairs and pushed open the spare room
door. For a moment Cathline mistook the woman who had just
whirled guiltily around for someone else, someone from her
painful past. The moment after she realized who it really was,
"Elizabeth what in hell are you doing skulking around like that?
Whose clothes are they?"
"Hi Auntie Cathline. I'm just sorting thru some of Dr Bexley's old
things." Elizabeth pointed to her new attire, "I guess I got a bit
carried away." Elizabeth's face had instantly gone into the
'innocent as a summers day' look that she'd developed over
many years.
"I'll say you did. Why are you wearing her clothes? They don't suit
you at all," Cathline commented.
"I was trying to get inside her mind. To try and work a few things
out for myself. If I'm to make any sense of all this." Elizabeth
gestured to the contents of the room. "Then I need to go beyond
just rummaging around at random. In understanding her I start
to understand myself. Cathline, when I was away at Cambridge I
discovered something horrible."
Cathline sat down on the floor, brushed her hair away from her
face, and said ,"Which is?"
"That unless I break free of my fear of Dr Bexley then I'll never
be able to love or trust anyone properly. I don't want that. Maybe
I'm making too much of it but that comes from what supposedly
went on all those years ago and what effect it had on the three
of you."
Cathline picked up on the key word in that sentence,
"Supposedly?"
"I have to keep an open mind on all things if my analysis is to be
accurate," Elizabeth refused to be drawn any further. Revealing
her plans to Cathline was the last thing she wanted to do. From
now on Cathline, Kat, and Matthew were the 'enemy'. The switch
in status was a logical one. She couldn't get inside the mind of
her late mother unless she thought exactly like her, had the
same prejudices as she did and viewed the world thru her eyes.
"I see. Is that why you wanted to look thru all her stuff?" Cathline
asked.
Elizabeth nodded. "I need to free myself of HER. This is the only
way'"
Cathline stood up and gave a brief nod. "Be careful. If you want
to wear her stuff then fine but the second we detect that you're
acting strangely this little experiment of yours is to stop, right?"
"Thanks Auntie Cathline," Elizabeth breathed a sigh of relief.
Cathline almost bolted out of the door. She ran almost full pelt
towards the beach where Matthew and Kat were still in full flow.
"Cheated? How can I cheat when we swapped Jetskis twice?" Kat was
saying.
"You two, "Cathline panted.
"What?" Kat turned to face Cathline.
"It's started, "Cathline said solemnly.
"What has?" Matthew asked.
"I caught Elizabeth going thru Dr Bexley's old stuff,"
"So, she said she wanted to help," Matthew stated. "What's the
problem?"
"She was dressed in some of Dr Bexley's old clothes. Actually it
was the outfit she wore when she first came to my house, but
anyway she gave me some spiel about needing to find out more
about HER so that she could find herself. She said she needed
to get inside HER mind in order to free herself, " Cathline's voice
had dropped to almost a whisper.
"What do we do? If we ban her she'll only go and do it anyway
when she's back in Cambridge. If we leave her alone then we
run the risk of losing her all together." Matthew now saw
the seriousness of the situation.
Kat thought for a few moments. Matthew had a point. "We let
her go thru with it but keep a close eye on her. If we push her
away now we might never get her back. At least this way we can
keep it quiet."
"At what point do we inform the authorities? When she starts
turning people into goo? When she builds her late mom's DNA
system again? Or when she murders a boyfriend that decides to
finish with her?" Cathline snapped.
"That's an overreaction, Cathline. There's no need for her to
undergo the test just yet. She's growing up, she wants to know
who she is and where she came from. That's a long way from
killing people," Kat answered back.
"I'm with Kat on this one. This is our daughter for Christsakes. I
was never happy about the arrangement as it was but it was the
only way to let her live. Now are we going to send our daughter
to something that could easily end up with her being committed
for life just because she decides to play at being 'hell bitch' for a
few days. Cathline, I know your role is to ensure that we stay on
track, as the counterbalance, but this is too soon." Matthew's
eyes showed a glint of tear. It couldn't be happening, could it?
"That's unfair Matthew. You know I love her like she was my
own. But we have a higher duty to ensure the innocent are
protected. You're right, it is too soon. I wish I'd never said what
I'd said. It seemed so heartless and cruel. The whole deal is
heartless and cruel. Let's just keep an eye on her and leave it at
that."
"Thanks Cathline. I hated the arrangement too. This business of 'Should
Elizabeth Stephens exhibit the same psychotic behavior as Dr
Elizabeth Bexley then she is to be screened and tested for
sociopath behavior. If the tests prove positive then she is
to be committed to preserve the lives of those she would come
in contact with.'" Kat's eyes were glistening with tears now. The
thought of her beloved daughter shut away in some institution
was almost too much to bear. This threat had hung over their
head for the past twenty years and now in spite of everything
they had done it looked to be happening.
-- o -- o -- o --
Elizabeth breathed a sigh of relief. At least Cathline hadn't
blown her top at her. She was under no illusions that her excuse
had done anything but muddy the waters a little. Cathline and
her parents were too smart not to know she was up to
something. However, there was no way that they could know
what that something was. Elizabeth considered the options for a
few moments. She could put the whole thing off until she got
back to Cambridge, but then she would lose access to all Dr
Bexley's effects. Proceeding as planned would create too much
suspicion, so there had to be some middle ground. In an instant
it came to her, she would act as normal but gradually get into
her Dr Bexley persona over a period of days. That way her
parents would get used to her wearing her clothes for example
and not get too worried.
After all, what had they to worry about? She wasn't about to go
killing people and whatever. This was a simple simulation, a
thought experiment. Elizabeth realized that she needed a way to
easily switch in and out of her Dr Bexley 'mode'. So that in her
mind she could flip between them and still preserve the integrity
of both. She decided that giving her Dr Bexley mode a different
name to herself would be the ideal way. She of course being
herself would still be Elizabeth, that much was obvious, but what
name could she give to the simulation?
She considered Lizzy, as that was suitably short and concise,
but somehow it didn't seem to fit. In order to name her Dr Bexley
mode properly she would need to choose a name that Dr Bexley
had used. Elizabeth considered Nemesis, but she had no
reason to revenge anyone, except maybe Nick. Hera was
another one she had used but Elizabeth had no control over all
living things. Elizabeth cast her mind back -- what was Dr Bexley's
first and last alias? That was it, Deianeria! That was the perfect
name for her new simulated persona. From now on when she
was being Dr Bexley she would refer to herself as Deianeria, and
when -- as she would be most of the time -- she was being herself
she would still be Elizabeth.
Elizabeth wondered if this dual name thing could be regarded as
a mild form of multiple personality disorder, but dismissed the
idea. Deianeria wasn't a separate person, she was simply the
name of a simulation; in just the same way someone names
a ship or aircraft. Elizabeth formulated the rest of her plan. She
would be Deianeria for the rest of the day but would continue to
wear the same clothes. It would take that long for the
Olanzapine to wear off anyway. Tomorrow after her swim she
would take some new clothes from the chest, and again
Deianeria would have to stay dormant. As the week progressed
she would become Deianeria for small amounts of time, and thus
not alert her parents and Cathline to what was really going on.
Elizabeth stood up, straightened her skirt, and after taking a last
look around for today stepped out of the room. In the distance
she heard Chopin being played from one of the side rooms.
Alex was practicing again. Elizabeth had to admit that Alex was
pretty good. Actually, Elizabeth thought Alex was good at a lot of
things. It was interesting to compare their relative strengths.
Whereas she was tidy, meticulous both in thought and deed,
Alex seemed to live his life as he went along. Maybe that's why
they needled each other so much. They were opposites pure
and simple. Elizabeth wasn't that interested in art or literature,
preferring the black and white, true or false that her meticulous
mind easily grasped to Alex's 'go with the flow' artistic flair.
She decided to go downstairs and see what Alex was up to -- she
felt up to some verbal sparring. It was something she liked about
him. But she couldn't help think that she was getting a little tired
of this constant oneupmanship between the two of them.
Alex paused playing as Elizabeth walked into the room, "Hi
Kiddo. That's not quite your look is it?"
Elizabeth looked down at her new outfit, "Oh, what? This? Thought
I'd play at being Dr Bexley for a while." How would Alex react?
Would he take this as a hint as to her intentions?
"Whatever, " Alex said, ignoring Elizabeth's comment.
"You've got better since I was last here, " Elizabeth commented
Alex pretended to fall off the Piano stool in shock, "You. You just
gave me a compliment! Where's my PDA! I need to note this
down"
"I said better, not good, "Elizabeth said with a smile. This was
more like it.
"Ok then, Miss Priss, you try, " Alex challenged. He knew full well
that Elizabeth wasn't anywhere near as musical as he was. In
fact his whole ploy depended on it.
Much to Alex's surprise Elizabeth agreed, "Ok, fine. I'll do you
a deal. You do my gene sequencing for me as well as I play the
piano, and I'll buy you dinner."
'She took the bait' Alex thought and held his hand out in order to
sign the deal, "And if you lose?"
Elizabeth had a thought, "Then you have go on a date with
Angela when you're next in Cambridge"
"Angela's cute but not as much as you are," Alex said with a
smile.
Elizabeth was a little puzzled. Was Alex making a move on her,
ridiculous! "Yes but she's available, I'm not!"
Alex looked around, "I don't see any boyfriends here."
"I didn't say I had a boyfriend," Elizabeth snapped. The subject
of boyfriends brought the pain of Nick's betrayal to the fore.
"Girlfriend? Now that'd be a scoop, " Alex raised an eyebrow.
Elizabeth gave Alex an 'as if' glare "Look, in the unlikely event I
lose I'll take you out -- you lose you go out with Angela."
Alex reached out to shake her hand. "One more thing?"
"And that is?" Elizabeth demanded
"You take me out in Male! You'll double cross me or something if
I wait."
"Fine! Now where's that spare stool?" Elizabeth said, and shook
on the deal.
A few minutes later Alex was laughing his head off. "Liz, you play
like a toddler who thinks a piano is a trampoline. Look, follow my
fingers."
Elizabeth was in a huff. She hated being laughed at. "Look, just
give me time. I can do anything I put my mind to."
Alex was still smiling. It was working out just the way he wanted
it to. Elizabeth could do with some humility. "That wasn't the
deal, was it? How much time do you want Kiddo? You've either
got it or you haven't. And Kiddo you ain't even close."
"Hmmph!" Elizabeth hated being shown up, especially in front of
Alex. Why had she gone along with this stupid bet?
Alex stood up behind Elizabeth and took hold of her hands. He
started to show her the finger movements in the correct pattern.
"It's ok I can do it now, " Elizabeth stated. She had memorized
the finger movements of this particular piece and was now
confident she could play it.
"Ok go then, " Alex said.
"Don't worry I will," Elizabeth stated. She was sure she had the
finger movements memorized.
"One more thing? Let's change to some Rackmaninoff," Alex
said with a grin and flipped the page over.
"Hey," Elizabeth protested.
"I never said you had to play the same piece did I?" Alex said,
his eyes alight with mischief.
Elizabeth gave him one of those looks that normally would wilt
the most stern of hearts. Alex however had endured years of
them and it now had the opposite effect.
Now Elizabeth was really cross. Nothing she did or said seemed
to faze Alex in the slightest. She never seemed to come out
on top of these tussles, and she could never work out why.
"That's enough! My turn now. You only have one chance at this.
Remember, if I win you go out with Angela next semester. You
have the following sequences available. Which is incorrect?
CCTGAATAAGAGCAGAGCAAATTCCCTAAAGGGAA and
CCTGAATAAGAGCAGAGCACATTCCCTAAAGTGAA." There, that'll teach him!
"Umm, What was that again?" Alex floundered.
Elizabeth gave Alex and evil looking grin. "You also have to tell
me why."
Alex furrowed his brow. Knowing Elizabeth, it wouldn't be easy. It
would be a trick question. But then again she would know he
knew that. Oh well, dinner with Angela wouldn't be that bad.
Alex took a wild guess, "Both of them. You made them up"
Elizabeth shot Alex a look! "I'll meet you at eight," and stomped
out. She was now well and truly pissed off at this constant one
up man ship even though she had participated in it.
Alex wore a grin a mile wide. It had worked out perfectly.
-- o -- o -- o --
Elizabeth thought about dressing up as dowdy as she could for
her dinner with Alex. Her parents and Cathline had reacted with
typical amusement at the result of the bet, so they were
no help at all. The only help her dad had given her was to
charter a helicopter to fly them over to Male. It seemed as
though Alex had planned the whole deal out. They would fly to
Male, and get a boat to Rangali before dining at the Hilton resort
hotel. Elizabeth really wanted to go in her jeans and T-Shirt but then
she would look the fool, not Alex. Then she had another idea.
She would go and see what Dr Bexley had in the way of
evening wear.
As nonchalantly as she could muster Elizabeth walked into the
spare room and started to search thru Dr Bexley's clothes. Like
herself, Dr Bexley liked to dress well, and surprisingly she liked a
lot of what she saw. There was no need to involve Deianeria in
the decision. After much searching she found an exquisite black
dress. It was strapless in design, and showed more flesh than
Elizabeth normally wanted, as the entire back was exposed as
well as almost all of the right leg, and it also had a plunging
neckline. Quickly stripping off her existing clothes, she put the
dress on, noting with satisfaction that it went in and out in all the
right places. It still needed a little something, something that
would guarantee she'd get all the attention and not Alex. That
was it! Garter belt. The cut of the dress meant that when she
walked she would expose the tops of her garters as well as the
straps. It would give her a 'slut' look, and normally she'd shy
away from such a look, but this wasn't a date, this was war!
Elizabeth couldn't find any of Dr Bexley's garters, so she scurried
back into her room and quickly put her own on. As expected, she
knew the effect her look would have on every male in the
room would be devastating. She knew Deianeria would be
pleased too, the perfect predator. She fished up her makeup kit
and proceeded to use it, not too much but enough to bring out
her high cheek bones and blue-gray eyes.
At seven fifty there was a knock on the door. Elizabeth opened it
expecting to see Alex but was surprised to see Bob, the local
chopper pilot. Her surprise turned to sadistic pleasure when she
saw his eyes widen and he tried his hardest not to eye up his
customer.
"Alex will meet us in Male," he managed to mumble.
"Ok let's go," Elizabeth said and followed Bob downstairs.
Matthew was sitting in the library when he saw Elizabeth waft
past. "My god, " he whispered to himself. Elizabeth had
somehow transformed herself into the very image of Dr Bexley
the night she'd proposed to him. It was an unnerving sight, as if
a ghost had just walked past. Matthew decided to say nothing.
Elizabeth had been acting perfectly normal all day and had even
fallen for Alex's little bet. Apart from dressing up there was
nothing to be concerned about. Matthew went back to his
reading. Alex sure was a lucky guy.
Elizabeth landed about an hour later. The chopper flight had
been short and boring. She had sat in the seats at the rear and
so didn't have the pleasure of seeing Bob distracted from his
job. A cab was waiting for her as she stepped out of the
chopper. "It's ok miss, Mr Richards will be waiting for you by the
quayside."
Elizabeth gave a nod. Alex had certainly planned this all out.
Ten minutes later Elizabeth saw Alex leaning against a street
lamp. On hearing the cab draw up he gave a wide grin and
moved to open Elizabeth's door. Elizabeth was about to
complain but decided that if Alex wanted to be the gentleman
then she would let him. It would make a nice change from
playing the clown.
"Why thank you, " Elizabeth said as Alex opened the door. She
noted with immense satisfaction that Alex's eyes were wide
open and that he had cast an appreciative glance up her
exposed leg. Now the hunter becomes the prey, Elizabeth
thought.
Elizabeth suddenly noticed that Alex was dressed in his casual
clothes "You're a little underdressed aren't you?"
"Not for what I have in mind. I knew you'd try and out do me and
you did. You look absolutely stunning. I don't think I've ever
seen you look so good but for what I have planned you'll have to
change."
Elizabeth took the compliment in her stride, she knew she
looked good. However she did see herself as being out
maneuvered yet again by Alex. Why didn't she think to ask what
she should wear! "This is all I have on," She complained.
Alex pointed to a small bag on the floor. I knew you'd do
something like this. That's why I brought you a change of
clothes. I'd hate for you to ruin that outfit."
Elizabeth snatched the bag off the floor and looked around for a
place in which to change. She spotted a small cafe a hundred
meters along the quayside and stomped inside. Once again
Alex had managed to make a fool of her!
A few minutes later she had changed into her old pair of skirt-
pants and blue T-shirt and had stuffed the dress inside the bag.
Walking back to Alex she had cooled down a little. Of course
Alex would try and do something a little different, so she should
have asked rather than get pissed at him. Would Deianeria get
pissed at him? Probably not. She would wait until the right
moment and then get him. Elizabeth decided that's what she
would do. "That any better?" She asked.
Alex gave a nod, "Perfect. Now we can get in the boat. We still
have a trip to Rangali to make."
Alex helped Elizabeth into the motor launch before getting in
himself. With a whir the motor launch's electric engines started
and they were underway.
Darkness had fallen suddenly and with the turquoise sea now
an eerie black Elizabeth had not much to look at. The garish
neon front of Male quayside had started to diminish. She turned
to Alex who was still looking at the array of neon lights falling
slowly away from them. Elizabeth sat crossed legged and just
staring straight ahead. In spite of letting Alex off a little for the
dress code mix up she was still annoyed to have been tricked
into coming out with him in the first place. She was however
honor bound to abide by the terms of the bet. "You can't get into
the Hilton dressed like this!" Elizabeth stated to Alex.
Alex shook his head. "You'll see soon enough."
Elizabeth was getting a little tired of this mystery tour game Alex
was playing but still couldn't help but be intrigued. Part of her
was enjoying it a great deal. Maybe she'd misjudged Alex. Not
wanting to give Alex any more entertainment or spoil the boat trip
she sat and looked out into the black ocean.
"Mysterious isn't it? I mean anything could be down there and
probably is, "Alex commented.
Elizabeth didn't reply. She knew very well what was down there.
Fish. She did however cast a glance in Alex's direction.
"Yunno Elizabeth, " Alex continued
Elizabeth didn't reply. She was still wondering what Alex had
planned for her.
"I'm not always out to show you up," Alex went on. If he was to
get any enjoyment out of this evening he had to offer Elizabeth
an olive branch.
'Yeah, right' Elizabeth thought but said nothing.
"Sometimes I am and that's because I just don't know how to
take you. How about we start again? Forget I tricked you into
coming and let's just enjoy the evening. Before we know it the
vacation will be over and we won't see each other again for a
few months,"
'Suits me' Elizabeth thought and nearly said it. But why was Alex
telling her all this? Why did he want to make peace with her?
Instead she shifted her gaze to the flickers of phosphorescent
light from the plankton that flowed from either side of the boat.
Alex tried again. He was tempted to make some sarcastic
comment but thought better of it "How do I handle you
Elizabeth? Every time I see you I am in awe of you. I guess my
teasing is my defense mechanism for me being tongue tied."
Elizabeth turned to look at Alex. Alex shy? Never! In awe of her?
No way. She couldn't resist answering this time "Alex I'm getting
fed up of me answering you and then you're twisting it around
and making me look foolish."
Alex gave Elizabeth a serious look, "That's what I'm trying to
say. We've been at each other throats, in a playful fashion since
we were little. I'm getting tired of pretending we're both twelve
but I don't know how else to deal with you."
Did Alex really mean this or was it some ploy? Elizabeth
decided to bite once more. If it meant the end of their constant
sparring then anything was welcome. "Then treat me as anyone
else not your kid sister."
Alex nodded, "I know it's just that..."
"Just what?" Elizabeth demanded
"Tell you later, " Alex said softly.
"I knew you'd do this too me! You always try and drag things out
for your own personal little games!" Elizabeth snapped.
"Elizabeth, It's not like that at all. I promise. Look we're nearly
docked. It's time for your surprise," Alex said softly.
Elizabeth noted the hurt look on Alex's face but couldn't be sure
if it was genuine or not. Anyway, as Alex said the boat was
about to dock.
Alex was the first off and took Elizabeth's hand to help her off
the boat. Strangely for Alex she did so without complaint. After
being passed their bags Alex pointed to the Hilton hotel, which
was a small walk away, "That's where we're going."
"If you say so, but they'll not let us in, "Elizabeth stated.
"Now the old Alex would now place a bet and trip you up, but the
new one is just going to say 'trust me'," Alex said with a smile.
They walked in silence for a few minutes until they reached the
elaborate entrance of the Hilton Hotel. It was split between the
two islands of Rangali and Ranglifinolhu and much of it was now
sited underwater. Only the tops of a few luxury lodges peeked
above the reef surrounding the islands. Elizabeth went to walk
inside the entrance but Alex pulled her to one side, "Not that
way!"
"Alex where are we going?" Elizabeth demanded.
"Round the side entrance, come on," Alex gave Elizabeth a
mischievous look and ran off.
Elizabeth raced after him, determined to see what harebrained
scheme Alex had cooked up. She followed Alex down a dark
side alley until the reached a door marked 'staff entrance'. Alex
indicated that they should go in there.
"Why are we here?" Elizabeth hissed.
"Shh," Alex said and rapped a sharp tattoo on the door.
A few seconds later and a small Hispanic man with short dark
cropped hair and wearing a white overall opened the door. On
seeing Alex he broke out into a wide smile, "Alex Hi. It's great to
see you again. It's been a while."
"Obrigado, Manuel. Faz muito tempo desde a nossa
pescaria," Alex said in fluent Portuguese
Manuel gave an even wider smile, "Thank you we must try to
meet up more often. This face I know. Elizabeth right?" he said
turning his smile to Elizabeth.
Elizabeth was mystified. Who were these people and how did
Alex know them? "Alex please introduce me."
"Oh I'm sorry. Manuel is one of the senior chefs here. I met him
last year while I was fishing. Anyway we're here to help him,"
Alex stated.
"Help him?" Elizabeth queried.
"Yep," Alex said with a smile.
"Not to eat?" Elizabeth was starving. What in hell was Alex
playing at?
"Not yet. First of all we have to earn it,"
Elizabeth grabbed hold of Alex's arm and pulled him outside,
"What do you mean 'earn it'?" she hissed.
"No I didn't forget my wallet nor is mom broke. How many five
star restaurants have you eaten at?"
"More than I can remember," Elizabeth admitted.
"How many restaurants have you worked at?" Alex asked with a
smile.
Elizabeth said "None."
"If I'd have taken you out for a meal here then it wouldn't be
unique would it? You'd have it labeled as 'just another meal at a
top class hotel, boring!' This way we get to eat and have fun
beforehand doing something you've not done before."
"I guess," Elizabeth confessed. She must admit part of her was
finding all this good food a little dull. How did Alex know? So
that's why he'd dressed in casual clothes. They were going to
work!
Alex poked his head around the corner of the door and called
"Manuel, para começar, o que você tem para nós fazermos?"
Manuel's beaming face appeared around the door "What have I
got for you to do? Well Alex, You take the dirty plates and after
putting the remains in the trash you give them to Elizabeth for
washing."
"We're going to wash up?" Elizabeth stated.
Alex nodded, "Looks like it. Manuel will show us."
Elizabeth sighed 'oh well in for a penny'
Manuel led them inside to a vast kitchen area. Every surface
was immaculate and all around them the staff moved as though
in some kind of military operation. Elizabeth was impressed by
the efficiency of it. Manuel led them thru to a large container full
of boiling water.
Manuel showed Elizabeth. "We don't use dishwashers here as
they ruin the plates and they are much slower than this method.
Just put the plates in this rack here and drop them in. Careful,
this water is literally boiling. Pull the covers over like this, "
Manuel pulled a large plastic cover over the container and
locked it in place with five clips.
"Got it," Elizabeth said. This was a really demanding job she
thought sarcastically.
Manuel then pointed to a dial on the side of the container. "Turn
this three clicks and count to thirty. Now this is the careful bit.
Unclip the cover and gently pull the Racks out. Get Alex to help
you or you'll scald yourself. Since the water is superheated the
plates will be dry almost as soon as they come out. There we go,
that's it."
"Ok what's Alex's job?" Elizabeth asked.
"I told you. He scrapes off all the remains of the food and gives
the plates to you," Manuel said with a smile.
"Is that all?" Elizabeth asked. Once again Alex had got off
lightly.
"Alex goes fishing with me, so I give him the easy job," Manuel
grinned again at Elizabeth.
This was not turning out as Elizabeth expected at all. But she
had resigned herself to doing it. "Come on Alex, I need those
plates," she demanded. If Alex had the easy job, Elizabeth
decided she was going to do her best to make sure he did it
faster than he would like to.
"Already there," Alex smiled handing Elizabeth a stack of ten
plates.
Elizabeth soon got the hang of it. Actually it took her two goes to
perfect the technique and soon she and Alex were on autopilot.
Half an hour went by as if it was only a minute.
"You know what?" Alex asked handing Elizabeth a particularly
dirty plate.
"What?" Elizabeth had found the last half hour strangely
relaxing. She had nothing to do per se and so her mind had
relaxed. Thoughts of Deianeria had been lost in the routine of
grab, stack, dunk and unpack.
"When asked to describe relativity Albert Einstein once said that
if you were sitting on a hot stove two minutes seemed like two
hours but when you were with a beautiful girl two hours seemed
like two minutes. I just want you to know that this seems like two
hours!" Alex's eyes were gleaming with mischief.
Elizabeth couldn't help but smile inside. She was still holding the
drying up towel in her hand and gave Alex a playful flick with it.
"You!"
"Better hurry up -- we've only got half an hour left," Alex stated
and handed Elizabeth some more plates and bowls.
"Til what?" Elizabeth said. Much to her amazement she was
really enjoying herself. Once she'd got over the fact that it was
Alex she was with she found herself enjoying his company.
"Til we eat of course. I promised you a meal didn't I?"
"I'm starving. Hand me those plates and no more talking,"
Elizabeth ordered.
"Yes Ma'am, " Alex gave a salute.
Half an hour later Manuel came and inspected their work. He
gave a broad smile and nodded his approval. "Alex sua
presença é pedido na praia"
"Thank you Manuel." Alex said and fished inside his pocket and
removed a blindfold.
"What's that for?" Elizabeth demanded.
"You. Now put this on. I'll lead you to where we need to go,
"Alex said handing the blindfold to Elizabeth.
"You're not going to make me walk into a swimming pool are
you?" Elizabeth stated. Things got more and more mysterious.
"No. Here let me help," Alex said placing the blindfold over
Elizabeth's eyes. Elizabeth instinctively went to pull it off. She
hated being out of control. She felt Alex's strong hand take hers
and she decided to let him play his little game with her.
Still holding Elizabeth by the hand Alex let her down the street
and back onto the quayside. For her part Elizabeth was
expecting to fall into a swimming pool, be left blindfolded in the
middle of the street or some other such humiliating scenario.
She had decided to give Alex a chance, so it was now down to
him to prove or disprove the trust she'd placed in him.
Alex knew exactly where her was taking Elizabeth. "Wait here
and don't move." He instructed Elizabeth.
Not having any choice except by ruining the game, Elizabeth
stayed still hardly wanting to breathe. To her surprise she found
the constant suspense and surprise exhilarating. She'd hadn't
had that many surprises for a long while, and the feeling of being
out of control of one's destiny and future was an intoxicating
one. Deianeria would disapprove of course but she had been
put aside for a few days. She felt Alex's hands lift her up around her
waist as though she was made of paper. She hadn't realized
how strong he was before. She felt a slight swaying motion as
Alex put her down. So Alex had put her on a boat!
"Why are we on a boat?" She asked.
"Because that is where we need to be," Alex answered
cryptically.
"Ok you win," Elizabeth admitted. She was by now totally
mystified and enthralled by Alex's little games.
Elizabeth had no idea how long they were on the boat but
she guessed it would have been about twenty minutes. Alex had
insisted on her keeping her blindfold on, and by now Elizabeth
didn't really mind. She was now sure that Alex wasn't going to
trick her. She felt a slight bump as the boat docked
somewhere. It couldn't be that far away from where she'd
started off. It would be just like Alex to make her go in circles for
a while and then they'd arrive back where they started. She
hadn't detected any changes of course, however. So where were
they?
"Elizabeth, hold still," Alex said and Elizabeth felt herself being
lifted up once more by Alex. She was now completely at his
mercy and somehow it had a releasing effect on her. She felt
herself being placed onto a quay and told to stay there.
A few seconds later she felt Alex grab her hand once more and
gingerly she started to be led by him. All she could hear was the
wash of the water against dockside wooden beams and then the
wash of water on the ocean shore. So she wasn't on a resort
island then? She would have heard music by now if she were.
Now what non resort island was within twenty minutes of
Rangali? In her mind's eye a map of all 1,195 islands that make
up the Maldives appeared. She traced all possible routes from
Ranagli and drew a circle representing a twenty minute journey
time around it. Only one place stood out, Hukurudhoo island.
"Alex, I know where we are!" She whispered.
"I thought you might. That photographic memory must be useful
sometimes," Alex smiled. He was within twenty feet of where he
needed to be.
"We're on Hukurudhoo," Elizabeth stated triumphantly.
"Wait," Alex commanded. Elizabeth did so.
Elizabeth felt Alex reach around the back of her head and
remove the blindfold. It took a few moments for her eyes to
adjust to the difference in light, and after the blurs had focussed
she looked around.
In front of her was a dining table. By the looks of it, it had come
from a five star restaurant as it was ornately laid out with what
looked like a silk table cloth. Standing on two tall stands was two
flaming torches. The firelight cast flickering red, yellow and white
light all around the area and it spread all the way to the ocean
just a few feet away. Sitting beside the table were several large
plastic boxes and to one side in a bucket was a bottle of
champagne. On the table were two wine glasses, and on one of
the chairs a large bouquet of exquisite orchids.
"Alex, what is this?" Elizabeth asked.
"Dinner. You like it?" Alex said with a smile. He knew she did!
"It's, it's...," Elizabeth started. She'd never dreamed that Alex could
come up with something this inventive, this surprising. She had
misjudged him for a long time. There was now, clearly, much
she didn't know about him.
"Come on, I don't know about you, but I'm starving. Here let me,"
Alex said and showed Elizabeth to her seat.
Elizabeth picked up the orchids and gave them a sniff. Their
fragrance assaulted her senses. The smell was like nothing she
had imagined. It had flavors of the orient, the amazon and lofty
alpine peaks. It was, she decided, a world map of scent and the
most incredible array of flowers and colors she had ever seen.
"Alex, this is incredible. It must have cost.."
Alex sat down on the opposite end of the table and looked
Elizabeth in the eye. "Doesn't matter. This is OUR evening. Now
the small blue plastic box contains our starters. I took the liberty
of ordering for you. It's hard to get the staff this far out."
Elizabeth smiled, "So we are on Hukurudhoo?" She passed Alex
the blue box.
"Yep. I never could keep anything from you for very long, could
I?" Alex said as he reached down and retrieved two plates from
a red box by his feet. He gingerly put them down on the table.
"Good they're still hot."
Elizabeth noted the Hilton hotel's logo on the sides of the china
plates. So Alex had got the stuff from the Hilton. "It all fits," she
stated.
"What does," Alex said, spooning some kind of seafood platter
onto Elizabeth's plate.
"The reason why we had to work for our dinner. Manuel needed
two people to cover for him while he sent two of his guys out to
do all this." Elizabeth gestured to her exotic surroundings.
"Right again. He'd be in real trouble if he suddenly went two
people down on a shift. Therefore we had to fill in while they
went off and did all this. Besides, it adds a little more spice to
evening."
"Thank you Alex. I don't know what to say. It's wonderful,"
Elizabeth admitted.
Alex finished serving up the starters and poured two glasses of
champagne He gave one to Elizabeth and kept hold of the
other, "Thank you. It's taken me ages to plan out. Here's to us."
With a clink they tapped glasses.
"Elizabeth?" Alex asked.
"Yes. This seafood is fantastic," Elizabeth commented.
"You've not been yourself since you arrived back home from Cambridge.
You've been on edge all the time you've been here. What's up?"
Alex said, the concern showing in his eyes.
"It's just a project I have going on that's all." Elizabeth didn't
particularly want to ruin the mood by talking about that.
"It's more than a project to you, isn't it? You seem to forget I
know you more than you do yourself. We grew up together. I
know when something's up. I think I know what it is," Alex said,
putting his knife and fork down.
"What is it?" Elizabeth said a little defensively.
"Judging by you going around wearing Elizabeth Bexley's old
wardrobe, I think you're doing an in depth study into the Fury.
Trust me it's a pointless exercise."
Elizabeth's face had turned to stone. There was no point in
denying it. How did he know? "It's not a pointless exercise. Don't
you want to know the truth?"
Alex shook his head, "Why bother? What's done is done. It all
went on over twenty years ago. We can't change what occurred
all that time ago but we can -- and we all need to -- move on from it.
Mom, Matthew, and Kat, and you too."
"Even if what we've been told is a lie?" Elizabeth stated.
Alex studied Elizabeth's face. Her blue-gray eyes were afire.
This was important to her! "It's not a lie, Elizabeth. Sure, the
government has classified everything to do with it, and that's
helped fuel the lie that my mom and yours made this all up, but
what about all those people who were affected by Bexley? You
can't create a conspiracy with that many people in it. Sooner or
later someone blabs and it's all out in the open. All this
investigation is doing is screwing with your mind."
Elizabeth was now feeling a little angry. Deianeria wasn't
screwing with her mind. Deianeria was an essential part of her
getting to know herself. Alex couldn't know the desperation she
felt, and had felt for some time, about her fears for the future. She
was right about not telling Alex about Deianeria after all.
"Thanks for your concern Alex. But it's not you who looks like
HER is it? It's not you who's had those cult bastards after you.
I need to know all about this. It's not for them, it's for
me. I need to know who I am."
Alex nodded, "I know. You remember when I tried to find my
father's body a while back? Mom told me he had been killed
during the guild war after screwing her when she was in
Osman's harem. She never even knew him, didn't even know
she was pregnant until much later on, and she raised me as best
as she could. I know she's been lonely ever since John was
killed, and in spite of the rumors I know she's not had any one
else. She doesn't want anyone else! I know what it's like not to
know who you really are. At least you know where you came
from. I gave up on trying to find him, I spoke to everyone who
was there at the time, Mom, Tina, Scott and everybody, but they
had no idea and could offer no leads. So I dropped it, figuring
that what mattered was that my family loved me and that who I
am is only up to one person, me."
Elizabeth felt a little guilty about being angry at Alex, "I
remember your search. You ended up looking more sad and
depressed than I can ever remember."
Alex nodded, "It took me months to get over that
disappointment. Listen, all that awaits you if you persist with this
project of yours is pain and fire. I'll leave it at that. You make
your own mind up. You always did and always will. It's one of
the things I like about you."
Elizabeth had to concede Alex made a valid point, but her pride
was at stake. She had to prove the Bexley cult wrong for herself
and for the world. All that she held dear was in danger until she
did. She decided to let it drop. It would ruin the evening if she
carried on as she did. "You'd better hurry up. I've finished my
starters,"
"Ok, will do," Alex said and started to eat once more.
Alex had only half eaten his starters so Elizabeth took a further
look around. It wasn't cold outside and a gentle sea breeze just
kept things from being too humid. The gentle lapping sound of
the water relaxed her and she found the setting more idyllic than
even her parents island. After all that was just home, this was
close to heaven! Elizabeth studied Alex's face. She hadn't really
noticed it but he had inherited Cathline's look of integrity and
nobility. Of course his jet black hair and dark complexion came
from his unknown father and his deep brown eyes gleamed with
sharp intelligence, wit, and compassion.
"Time for the main course, pass me the large yellow box please,
"Alex asked.
Elizabeth did so, boy was it heavy, "What are we eating
Elephant?"
"Nope just Manuel's special duck,"
Elizabeth cast her mind back to the conversation on the boat
going over from Male. "You said you were in awe of me? Why"
Alex waited until he'd placed a perfectly cooked duck breast on
Elizabeth's plate, "Because I am. You are the most remarkable
woman I have ever met. You are just simply devastating, in
intelligence, beauty, and heart. That's why I get so tongue tied
around you and resort to teasing. I have no idea how to handle
you."
"You trying to seduce me?" Elizabeth asked with an incredulous
look on her face. Alex and herself, what a joke!
Alex gave one of his beaming smiles, "What I was trying to say
to you on the boat was that in spite of everything we've done to
each other, the jokes, teasing and fighting, in spite of the big
brother act, I can't help but admit to you I'm falling in love with
you. I didn't plan it this way. It just happened."
Elizabeth dropped her fork in shock. Alex in love with her? How
come? "Alex this is the most cruel joke you've played on me.
How dare you!" she snapped and rose from the table.
Alex stood up and grabbed hold of her arm, "It's no joke
Elizabeth. I realized while you were away that I missed you.
That I wasn't able to be the person I wanted to be while you
weren't around. Elizabeth. I love you. There I said it!"
"I don't know what to say," Elizabeth said. How had it come to
this?
"Neither do I. Not any more. It's taken me years to work out
what it was that made me so awkward around you. Please tell
me how you feel," Alex said.
"Feel? I feel confused. How can you fall in love with me Alex? I
thought you hated my guts. We're opposites in everything we
say and everything we do." Elizabeth walked away from the
table. She needed to think for a while.
Alex walked after her and soon caught up. "Elizabeth do I have
any chance with you? Please I need to know."
"Alex I just don't know. I came on this date thinking you were
setting me up and now you tell me you're falling for me."
Elizabeth turned to face Alex. She looked up into his eyes. They
were full of expectation, fear and concern. He was telling the
truth.
"I'm sorry. I needed to get you on your own so I could tell you. I
just had to, otherwise I'd live my life out in 'what ifs' and maybes.
You want to find out who you are, let's both find out who we are
together." Alex's voice was now a whisper.
To her surprise Elizabeth didn't move away. She didn't know the
reason, just that to move away would be wrong. It was as if
some external force had paralyzed her legs. Her heart was
telling her to stay, and in matters of the head and heart the heart
always wins.
Alex took hold of her and drew her close. To his surprise he felt
no resistance and he moved in and kissed Elizabeth on her lips.
Elizabeth pulled away. "How dare you!" she snapped, and
slapped him full around the face.
Alex turned to leave, his heart in tatters.
"No you don't! come here!" Elizabeth roared and pulled Alex
back towards her. Then much to Alex's astonishment Elizabeth
kissed him back.
Elizabeth felt as though a fire within her had been lit. Her mind
told her that kissing Alex was an insane thing to do. That no way
this would work out and the only reward would be pain, and loss
of a good friend. Her heart told her that something within them
had just connected. It was as if two souls had just joined for the
first time after centuries of searching. She felt Alex pull her
closer to him and his strong arm enveloped her waist. Every kiss
they shared made her feel more alive than she ever had been
before.
Instinctively she unbuttoned his shirt and ran her hand over
Alex's strong, muscular chest. Alex was kissing her neck and
gently kissing her ears. Tingles ran down her spine -- this was so
right! How had she been so blind?
She managed to pull away for a second, "Alex we need to talk?"
Alex stopped kissing Elizabeth's neck and nodded his
agreement, "I'm sorry. This just felt so right."
Elizabeth put her finger to his lips, "Don't be sorry, it IS right. I
never realized it before but I feel as though we just connected.
Like this was supposed to happen."
Alex took hold of Elizabeth's hand and drew his arm around her.
"I know. Scary isn't it? Where do we go from here?"
Elizabeth put her arm around Alex's waist. She felt safe and
secure there. It was an unfamiliar but welcome feeling. "One
step at a time. Starting with dinner."
Alex turned and gave her a peck on the cheek, "Always the
practical one."
A few minutes later they had both sat down and were playing
footsie under the table. Alex felt a tingle every time Elizabeth ran
her foot around his. He couldn't believe that this incredible
woman wanted to be with him. His heart was soaring and he
had never been so happy or content. It was as if his entire life
had led up to that kiss on the beach. Whatever tomorrow
brought he would always have that kiss.
The young couple on the beach spent the rest of the main
course looking into each other's eyes, holding hands at the table
and making small talk. Whatever or whoever had brought their
souls, their lives and their love together was establishing a
foothold and wasn't about to let go.
"Let's take a walk. Desert can wait, " Elizabeth said.
Alex nodded "Cherish the love, cherish the life."
"Sorry?" Elizabeth queried
"Old song. Sorry, " Alex admitted. What had made him say such
a stupid jerky thing?
Elizabeth wasn't into songs but Deianeria was. "How'd it go?"
Alex shrugged "I don't really remember. Sorry. I was just
thinking that no matter what happens tomorrow or the next day
I'll always cherish this night."
Elizabeth drew Alex along side her and rested her head on his
broad shoulders, "Me too," she whispered.
"Look I can see a ship in the distance. Wonder where's it
going?" Alex pointed to a row of lights near the horizon.
"Who knows?" Elizabeth shrugged.
"Just think. Out there," Alex pointed to the horizon, "There are
people meeting their someone for the first time. Millions and
millions of somebody's looking for their own someone."
"I guess so. I hadn't thought of it in that way," Elizabeth
admitted.
Alex gave a laugh and drew Elizabeth in for another kiss. She
responded then she broke away. "One step at a time."
Alex smiled, "Agreed. Where do we go from here, after desert
that is? I think we just see how it goes. Let's enjoy now and
worry about the kids later?"
"Kids? You expect me to have your kids? I've only starting to get
used to idea of you as boyfriend material," Elizabeth smiled
Alex checked his watch "Later. Look it's getting late. We'll take
desert back with us."
"Ok. Alex?"
"Yes?"
Elizabeth looked Alex in the eyes "Tonight has been wonderful. I
never dreamed it would work out like this or I would feel the way
I feel. I guess, deep down somewhere I liked you too. It needed
your courage to make me realize that. Maybe I was afraid to
look beyond my teasing and 'oneupmanship' to see what was
beneath."
"What is beneath?" Alex asked
Elizabeth pulled Alex in for another kiss. "Hope."
-- o -- o -- o --
Elizabeth woke up the next day feeling giddy and elated. Last
evening was surreal. Never in her wildest dreams had she
imagined that she would be dating Alex. Only a day ago the
mere thought would have either outraged her or reduced her to
fits of laughter. Now, only few hours after that first kiss the
thought no longer seemed repulsive or funny. In fact it seemed
quite the opposite. One thing concerned her about her new
relationship with Alex. Where did it leave Deianeria?
Elizabeth thought back to Alex's comments on her quest. He
was right to be concerned for her but he was very wrong about it
only producing hurt and pain. She had to know. This was more
than a scientific experiment, it was her only way to free herself
from the past. She was grateful to James, the cult leader, as she
would not have dared go where she was going without his
challenge: 'Prove me wrong!'
Maybe in unearthing the truth about Dr Bexley she would
stumble across something about Alex's father. If not only for her
sake, what a relief that would be for Alex! No, Deianeria must
continue, that much was certain. In a way her dating Alex was
the perfect smokescreen. There is no way suspicion could be
aroused if she was in a healthy relationship. It was worth
bringing Deianeria in early, as now she had the perfect cover. If
asked she could state she was looking for clues about Alex's
father. That was true to a point, although she wasn't sure what
Cathline's reaction would be.
Elizabeth checked the clock on the bedside table, it was seven
am and she was the only one up. Alex normally had a lay in until
ten, with her parents rising at about eight. As always Cathline
was a wildcard but Elizabeth knew she could handle Cathline.
Wearily she got out of bed and headed towards the spare room.
She would change into some more of Dr Bexley's clothes and
do some research before breakfast. She decided to try out
Deianeria as she had planned it. For the duration of her
research that morning Elizabeth would be gone and only
Deianeria would remain.
Elizabeth closed her eyes and concentrated, she breathed in
and out and performed her relaxation technique. In her minds
eye she imagined filing away Elizabeth into a PDA and loading
Deianeria into her active area. The process took a few minutes
as Elizabeth prepared herself for the simulation.
When it was complete Deianeria stood up and stretched. It had
been too long. After having a quick look around she walked out
of Elizabeth's bedroom and into the spare room.
Her first thought was how messy everything looked but she
resisted the urge to tidy up. Elizabeth could do that for her.
The first thing she needed to do was check the journals and
figure out a plan of action. Whatever had gone on before, it was
clear that Elizabeth had been too nice and too discrete. Such
methods would take far too long and eventually lead to the
wrong result. Deianeria decided that it was time for no more nice
miss priss.
She thought back to the hurt that Nick had caused Elizabeth. He
was a bastard, no doubt about that. Something would need to be
done about him. But first the journals. She eventually found a pile
of small notebooks lying in the bottom of one of her chests. The
first three contained writing, and they weren't the ones she
wanted. They were for public consumption. The real ones she
wanted were the blank ones underneath. All she needed now
was an ultraviolet light source. She was amazed that nobody
had wondered why she'd kept seemingly empty notebooks, but
then again people were stupid like that. She would have thought
Kat and Cathline might have deduced it but then again with all
threats gone there was no reason to suspect anything.
Deianeria glanced down at herself, still wearing Elizabeth's
nightdress. It was time to change all that. She stood up and
found a suitcase with some of her favorite outfits in. She quickly
chose a deep purple blouse with a bleeding heart embossed on
the left breast and after a bit of searching found her long black
skirt. It was a shame Elizabeth had cut her hair short, but it
would soon grow again. Feeling much better, she went back to
her searching.
A few minutes later she found what she was looking for. It was a
large hardback book entitled 'Human Molecular Genetics'. Of
course much of it was out of date now but it wasn't the contents
she was after. She flicked thru several pages, scanning each
one until she reached page 473. She had noticed that the letters
on each line in the second paragraph spelt 'Guild'. Flicking to
the right she saw a series of numbers. Taking the first three lines,
a telephone number was formed. She quickly memorized it and
decided to go and give it a try. She still needed a UV light of
some description in order to read the notebooks.
The house was quiet and to her satisfaction she noted that
nobody had yet woken up. She checked the grandfather clock in
the hall. It was seven thirty. She had half an hour left before
Elizabeth would be needed. Just enough time to make the
phone call. She dived into Matthew's office and dialed the
number. To her surprise an Arabic voice answered "yes"
"Hello, this is Deianeria. I have a job for you."
-- o -- o -- o --
Cathline had found it hard to sleep and lay in bed trying to rest.
"This is no use at all," she muttered and swung her long legs off
the bed. She couldn't sleep for any reason she could think of it
was just one of those nights. She debated going for an early
morning swim and indeed Elizabeth would probably be there so
it would be a good excuse to see what she was up to. She also
wondered how Alex had got on with Elizabeth the previous
evening. She had heard them come in about 2am, so it couldn't
have been that disastrous for them. That was another thing she
would ask Elizabeth when she saw her.
Deciding on an early morning swim, she took off her nightdress
and found her black thong bikini. There weren't many women of
fifty who could still wear it and carry it off but Cathline was no
ordinary woman. Her specially designed body seemed to age at
half the rate of other women's and she could still pass for a
woman in her early thirties. She adjusted her eye patch and
went outside into the hallway. As she walked past Matthew's
office she heard the faint sounds of music coming from inside.
"Can't you see what you are doing to me?
Can't you see what you have done?
As I try to pass another long and sleepless night,
A hundred crazy voices call my name,
As I try to pass them by,
I almost can believe that she is here,
Here in the glow of the night.
Do you know what you have done?
Do you know what you've begun?
Do you see we shall never be together again?
All of my life."
Cathline decided to investigate and opened the door.
The room was in darkness and only the lights from the hi-fi lit
the room. Cathline's eye quickly adjusted to the darkness and
she saw a figure sitting on a chair.
"Hello Cathline," the voice said and the music stopped.
The tone sent a shiver down Cathline spine. It was the same
tone and intonation as Dr Bexley had had when she'd said those
same words to her so many years ago.
"Elizabeth?" Cathline queried.
There was a pause for a few moments and the figure spoke.
Her voice, it was almost a different voice from a different person.
Cathline however couldn't be sure -- there was subtle differences
in the intonation and intent. Where the previous one had been
full of veiled menace this was full of warm greeting. "Hi Auntie
Cathline. Did I freak you out?"
Freak out wasn't the words Cathline would have used. "I did
wonder what'd you doing in the dark?"
"You never listened to music in the dark before? Lights."
The lights slowly came on and showed Elizabeth sitting on
Matthew's chair with her feet on the desk. She had number of
notebooks on the table and Cathline caught a glimpse of that
bleeding heart motif on Elizabeth's blouse.
"What are you doing still wearing her clothes. I thought that joke
was over by now?" Cathline demanded
"What?" Elizabeth glanced down. She couldn't remember
putting that blouse on. How'd she get into Matthew's office
anyway? Cathline mustn't be made more suspicious than she
already was. "Sorry, I just thought it looked a neat outfit. Mom
and Dad's room is directly below the entertainment room and
I didn't want to wake them up so I used dad's office."
Cathline was still suspicious but as usual Elizabeth had a
plausible explanation for everything. So she decided to let it
pass and tell Matthew and Kat about this latest episode as soon
as she could. She decided to change the subject "How'd it go
last night."
Elizabeth thought back to that wonderful dinner and her first kiss
with Alex. It would be better if Alex and she told their
respective parents at the same time. "It went ok. Alex surprised
me."
"How so?" Now Cathline was intrigued. Elizabeth wasn't often
surprised.
"He made me wash up and then we ate. He also knew the chef
at the Hilton and spoke Portuguese. I didn't know he could do all
that stuff."
Cathline gave a smile. That was typical Alex. "There's a lot
about my son you don't know. You know he'd been planning that
for weeks?"
Elizabeth nodded "So I gather. Anyway I'm sure you'll hear all
about it later when he bothers to wake up. Speaking of waking
up, you look dressed for a swim. Want some company?"
Cathline almost breathed a sigh of relief. This was the normal
Elizabeth speaking. "Sure."
Elizabeth smiled. "I'll just get changed and I'll join you in a few
mins. If you can keep up that is!"
"Yeah, right. I've a four inch height advantage over you,"
Cathline stated. 'Let's see how she reacts to goading' Cathline
thought.
"And I've got twenty years on you. I'd better hurry," Elizabeth
collected the blank notebooks and ran upstairs.
Elizabeth was confused. How and why was she in Matthew's
office. She didn't remember getting dressed either and why was
she holding some blank notebooks? There was only one
conclusion -- it must have been Deianeria. Elizabeth reached her
room and started to take off the blouse and skirt. She
accessed the Deianeria simulation, and she then knew why she
needed the notebooks. She had remembered seeing them
stacked in a box in the spare room but had paid them no
attention. Now, it would seem that the notebooks could be the
keys to it all. Strange how'd she'd overlooked them before
and gone onto other things. The outfit Deianeria had chosen
was cool but what else had she found before Cathline had
interrupted her? Elizabeth couldn't quite remember, so she
dismissed it as either unimportant or irrelevant.
She did find it disconcerting that the Deianeria simulation
seemed to have a life of her own and that seemingly Elizabeth
was out of the picture while Deianeria was active. However,
Elizabeth took comfort from the fact that although Deianeria
could do things that later Elizabeth had no immediate
recollection of, it was Elizabeth who had final veto and control of
-- effectively -- the on/off switch.
Elizabeth quickly put on her swimsuit and went downstairs to the
pool.
-- o -- o -- o --
Alex got up at his customary ten am and proceeded to take a
long shower. He couldn't believe the events of last night. How
could someone like Elizabeth fall for a clown like him? Elation
was too mild a word for the way he felt. It was though he had
hooked into his destiny and nothing in heaven and earth could
prevent him from entering into it. He knew by now that everyone
would be up and awake, and wondered if Elizabeth had told
anyone yet. He suspected not, as she would want him to see
Matthew, Kat and Cathline's faces when they broke the news.
Anyway it was time to face the music and his new beloved! Alex
dried himself down and put on his now customary shorts and
wild patterned shirt. Walking downstairs and outside to the pool,
he found Elizabeth still swimming lengths. Cathline was
allowing the sun to dry herself off. Matthew and Kat were at the
far end of the pool just pouring themselves another cup of
coffee.
"Hi folks," Alex called out.
Elizabeth stopped swimming for a second to give Alex a wave
and a wink. Alex's heart leapt once more. She hadn't forgotten.
It wasn't a one off! She IS mine!
By the time Alex had walked around the other side of the pool to
join his mom Elizabeth had pulled herself from out of the pool
and was standing beside him. She gave Alex a crafty look and
then took hold of his hand. Alex was pleased to see the shocked
look on Cathline's face as she noticed their held hands. The
look of shock turned to a wide grin and she said "You two kept
that quiet!"
Kat had just finished pouring Cathline's black decaf and had
glanced round to check if Cathline was still there. Much to her
amazement she saw Elizabeth and Alex holding hands! Now
that was a turn up for the books.
"Liz?" Kat called.
Elizabeth whirled around but tellingly still had hold of Alex's
hand. "What mom?"
"How long has this been going on?" Kat asked with a smile. It
was so good to see Elizabeth in a relationship. They were
starting to get worried.
"Since last night. Anyway, we're off to Male after lunch for some
shopping. You want anything?" Elizabeth asked. She was after
one item in particular, a UV light with which to read the notebooks.
Kat shook her head. "No thanks. John left first thing with the
yacht. You'll have to fly."
"Suits us." Alex called back.
"We're just off for a walk to Stephanie's cove," Elizabeth called.
Kat gave Elizabeth a permissive nod. It really WAS so nice to
see them together. She'd had a suspicion for a while that
something like this going to happen, but now that it had she was
determined to give them enough space to make their own minds
up.
Cathline walked over to collect her coffee as Elizabeth and
Alex walked off, still hand in hand. "Remind you of anyone?"
Kat smiled, "Maybe, but Matthew and I never fought as much as
those two did. "
"We never fight," Matthew joined in.
"Yeah right. I've seen you on a Jetski," Kat jibed.
"We'll just let them get on with it," Matthew suggested,
"Just what I was thinking," Kat replied.
Cathline's face took on a serious look, "I caught Elizabeth in
your office today Matthew. She was still wearing Dr Bexley's old
clothes and she was sitting in the dark listening to music. When
I walked in she spoke to me just like SHE did at the height of her
fury. "
"She often goes in my office when she gets up early. That way
she doesn't disturb us. What'd she say?" Matthew stated
"All she said was 'Hello Cathline.' She then waited for a few
moments and then her voice was perfectly normal again,"
Cathline stated.
"I dunno what to think. Now she's going out with Alex I think
she'll be ok. He'll notice anything awry soon enough. I think she
enjoys stringing us along. I think she's trying to wind you up,
Cathline," Kat said. Elizabeth could be such a tease when she
wanted to be. Not in the overt way that Alex was but she
enjoyed playing mind games with people for her own
amusement.
"It IS nice to see them together isn't it?" Cathline commented
once more.
"Sure is. I don't know how long it will last once she starts back to
Cambridge. Mind you she's back at Harvard next year so it
should make things easier for them, if they last that long that is,"
Kat commented.
-- o -- o -- o --
A few hours later Alex and Elizabeth returned from Male. They'd
spent some of their time shopping but mostly they had spent
their time just being together. Places that had become mundane
and routine as they had grown up now seemed fresh and new
when they were together. Elizabeth was happy, as she'd
managed to obtain a small UV lamp from a photography shop.
She had told Alex she needed to study, to get ready for her next
term, and would he mind leaving her alone for a few hours. She
promised she would be with him for dinner, and that seemed to
pacify him. In any case Alex had wanted to fly the model aircraft
he'd made with John the summer before, so that was fine with
him.
Elizabeth plugged the light in and retrieved the first notebook.
Was it worth getting Deianeria involved? Not at the moment -- this
was study not simulation. Once she had more information then
she would invite Deianeria to help out.
Elizabeth placed the first blank page under the light and after a
few seconds writing appeared.
"Exile Day 4
Took the plane to Lhasa. The flight from the US was torture, I
was expecting to be hounded by the press but they didn't
recognize me. I can't believe Matthew has done this to me. I
knew he was after something when he jilted me but it seems
he's out to frame me for kidnapping!
What in hell does he want from me? Anyway I've taken the best
way out I can think of. I'll spent a few weeks in Tibet. It's a place
I've always wanted to go to and this is as good a chance as any.
Hopefully by the time I get back this will all have died down."
Elizabeth stopped reading. She didn't believe what she'd just
read! She got up, switched the light off and went to the spare
room. After a few minutes of frantic searching she found one of
Dr Bexley's old workbooks from when she was at Harvard.
Elizabeth also took one of the normal notebooks back for
comparison.
In her room she opened the normal notebook and placed it
alongside the blank one. She switched on the light again and
studied the handwriting. Too all intents and purposes it was the
same handwriting. However, closer study revealed that the loop
of the 'e' and the tail of the 's' were a little different on the normal
one. She then opened Dr Bexley's old workbook and studied the
handwriting on that. It took a few moments for her to study the
page but the evidence was clear. The person who'd written in
UV ink and the workbook were the same person. The person
who'd written the so called diaries of Dr Bexley was a
DIFFERENT person altogether.
She quickly got her PDA out and placing it screen down on each
book scanned a page from each. "PDA find the foremost
handwriting expert who can give me 24 hour turnaround on the
samples just scanned. Mail them to him and let me know the
findings"
"Yes Elizabeth," The PDA answered back.
Elizabeth flipped to the next page of the blank notebook and
continued to read.
"Exile Day 6
Arrived by land rover in Qinghai province. There's a nice hostel
just inside the border, which I'll be staying at for a while. I'm
looking forward to the expedition. It's not every day you get to
go on a trek to find new medicines. Hopefully it'll take my mind
off Matthew and his scheming friends. I can't believe how
brazen they were, talking about their plans to defraud us in the
restaurant like that. It's by chance I overheard them on my way
to the conference. Even Cathline is involved. Just how deep
does this conspiracy go?
I was staggered when I saw an identical copy of me walk in and
sit at their table. Whoever did the surgical reconstruction on the
woman did a brilliant job I was almost convinced I was looking at
a clone. That doesn't excuse what they are accusing me of.
Murder and Kidnap, yeah right, as if."
Elizabeth shook her head in disbelief. These books must be
forged, They had to be wrong. Elizabeth changed to the second
book.
"Exile day 93
Somewhere in Amdo province
I have had some horrible news. I can hardly bear myself to write
it. My parents are dead. They were killed in an auto crash a
week ago. I never even got chance to say goodbye. Mom and
dad, why?"
The letters looked a little smudged to Elizabeth. She thought it
looked as though Dr Bexley had been crying when she wrote it.
If that were the case then a DNA sample of the pages would
provide more proof to the case. After scanning in a copy of the
page with her PDA continued to read.
"The police say that they swerved to avoid a falling tree in a
thunderstorm and crashed over the edge of a cliff. The car
following behind was able to stop in time. Apparently they were
killed instantly. It also seems as though I am to go on trial for
murder. How can that be? I've been here for 93 days. It must be
that woman I saw in the restaurant. I have to go back to say
goodbye to Mom and Dad. I am now an orphan."
More smudges masked the rest of the page. Elizabeth sat back
on the chair, still shell shocked from the revelations on the page.
If the person who wrote this was really Dr Bexley, if the
handwriting and DNA matched, then it would prove that Dr
Bexley really was an unwitting victim of her parents deception.
She tore out the page with the smudges and placed it inside her
desk drawer. She would seal it off and sent it off to Cambridge
for comparison with her own DNA. She would know in the
morning if the handwriting matched, and that was good enough
for the moment.
She decided that after tomorrow she couldn't bear to stay any
longer in this house of liars. They may not have killed Dr
Bexley's parents but they did drive her away. The cult leader
was right after all. Hardly able to walk Elizabeth stood up and
walked to her bed. Unable to control herself any longer, she
burst into tears until she sobbed herself to sleep.
-- o -- o -- o --
When Elizabeth awoke the next day the notebooks and
workbooks were gone and her room has been tidied. Alex was
sitting on the chair next to her bed looking concerned at her.
"Hi Kiddo. You gave us quiet a scare, "he said softly
"I found it. I was wrong about them," Elizabeth sniffled. Why did
her arm hurt?
"No you weren't. They showed me the notebooks and the UV
lamp. They didn't do it. It was all a trick," Alex said gently
stroking Elizabeth's face.
"How can it be a trick. Where are they now?" Elizabeth glanced
down at her arm and noticed a small red pinprick. She'd been
injected with something.
"The notebooks? Your dad has them I think he's going to burn
them or something."
Elizabeth sat up, "No he mustn't. He can't!"
"I'll make sure he doesn't. We found you still crying last night --
you glared at us and shouted at us to go away or you'd kill us. It
really freaked us out, I can tell you. Who's De-an-era? "
"You mean Deianeria? That's the name of the project I've been
working on. Look, I'll be down in a few minutes. Thanks Alex."
Elizabeth said and gave Alex a kiss.
Elizabeth was worried. She had to get those notebooks back,
they were her only proof.
She decided to dress in her normal clothes and made her way
down for breakfast. Everyone was normal, too normal for her
liking. It showed they were worried about her.
"Hi Elizabeth. Glad to see you're feeling better," Kat piped.
Elizabeth decided that lying was the best way to placate her
parents. What action she would take now depended on the
handwriting and DNA results. "Sorry about last night. I guess I
goofed huh?"
"It was typical of Dr Bexley to write a false account that would
incriminate us if it ever came to a trial between her and us. Even
though she's been dead for years she still has the ability to
cause hurt to those we love. Elizabeth, please let this project
of yours drop," Kat pleaded.
Elizabeth had considered the fraudulent entry possibility, but that
didn't equate for the difference in handwriting.
Elizabeth just nodded in agreement and ate her breakfast. She
would have to see what Deianeria made of it.
An hour or so later, just as she was about to go into the pool, Kat
came running out with the phone. "It's for you -- I think it's
Angela."
Elizabeth grabbed the phone. It had been too long.
"Angela, Hi. How are you? Looking forward to going back?"
"Hi Elizabeth. How's that island of yours?"
"I haven't blown it up yet if that's what you mean. Listen, I've got
so much to tell you I can't wait to get back." Elizabeth was
delighted to speak to Angela again. After nearly two weeks it
had been too long.
"The reason why I called is that I have some bad news,"
Elizabeth's tone dropped. She knew Angela's parents were poor
"Look if you can't afford to come back I can help."
"No that's not it. You remember Nick, as in ex boyfriend Nick?"
"Yeah. He was cheating on me wasn't he?"
Angela's voice took on a more serious tone. "They found his
body in the Thames. It looks as though he'd been murdered. His
throat was slit and he'd been dumped in the river."
"Oh my God. Do they know who did it?" Elizabeth felt a tinge of
sadness. Nick had been nice and she would miss him.
"Nope. The press over here is calling it a Guild style killing. His
pockets were empty and his wallet gone so the police think it
was a simple mugging that went wrong. Oh Elizabeth, it's so sad.
I know he didn't treat you well in the end, but this is horrible"
"I know. I feel sorry for his parents. I expect they'll find out who
did it soon enough though," Elizabeth said softly.
Angela's voice gave her agreement. "I hope so."
-- o -- o -- o --
"Kat what the hell are we going to do with her?" Matthew asked.
"That Olanzapine injection should help her. Why did she freak
out like that? Sure, reading those notebooks triggered it, but even
that shouldn't have done it" Kat asked.
"You think she missed a few doses of her drug? If so how come,
she takes it everyday," Cathline asked.
"We'll know soon enough. I think she's worried about going back
and what's going to happen with her and Alex. She wouldn't say
it of course but that's a factor. That project she's got running is
taking a lot out of her. We ought to put a stop to it before it really
hurts her." Kat's voice was showing real concern. She couldn't
recall Elizabeth being this upset since she'd found out about her
real mother.
"We can't put a stop to it. If we try she'll think we're trying to
cover something up and it'll only make things worse," Cathline stated.
"Where are the notebooks anyway?"
"Locked away in my office safe. I changed the combination too,
so they should be ok in there. Cathline, do we inform the
authorities or not? I was against it at first but I'll do whatever's
best for her. If that means she's locked away for her own and
others' safety then that's a cross we have to bear. Matthew's
voice was full of sadness. The thought of his 'little mite' locked
away and unable to lead a normal life was almost unbearable.
However the thought of her killing anyone was worse. Who
knows what she might be capable of?
Cathline thought long and hard "No we don't. I know it's my son
in the firing line, if anything happens, but I can't do this to her.
Let's let Alex work this out with her. That's the one thing Dr
Bexley lacked, someone to care for her and love her, not in
a parental way but in a friend and lover's way. I know I wanted to
be that person to her, but she never really opened up to me. All I
was, was a means to an end. By the time I was on the scene it
was too late, the damage had been done. If Alex can be there
for Elizabeth then I see that as our only hope."
Kat nodded her agreement. "That's some wise words, Cathline.
But it's a big burden for Alex. Do we tell him?"
Cathline shook her head, "No. How can we? 'Oh Alex we just
thought you might like to know that your new girl friend could
turn on you and kill you on the slightest whim.' If we tell him he
will change his behavior towards her, and she'd
know something was wrong. Let's let love take its course."
"And if Alex dumps her? Then what?" Matthew said, an element
of fear crept into his voice.
"Easy. We get him out of there as soon as we can and make
Elizabeth submit to the test," Kat stated. It was the only safe
way out.
"Agreed," Cathline said.
Matthew nodded his agreement.
Kat just hoped Alex was up to it.
-- o -- o -- o --
Alex found Elizabeth in Stephanie's cove. She was sitting on a
rock looking out to sea. "Hi Kiddo. Need some company?"
Elizabeth turned to face Alex, her eyes red with tears. I'm sorry
Alex. Yeah, please sit down. I need to talk."
Alex nodded and sat down beside her. He put his arm around
her and drew her close. In response Elizabeth put her head on
Alex's shoulder. She needed him more than ever at the
moment.
"You're in a real state aren't you?" Alex said gently tousling
Elizabeth's hair.
Elizabeth gave a sniff and nodded. Her head still rested on
Alex's shoulder. "I messed up. I thought I could do it. But you
can't discredit the evidence I've found. There's something odd
going on Alex, but I can't put my finger on it."
"I didn't see the notebooks, but from what mom told me they
were from a diary Dr Bexley had written about a trip to Tibet.
They named Matthew, Kat and mom as trying to set her up.
Elizabeth, you can't verify Dr Bexley's story. By now all records
of her trip would be gone and all a handwriting expert could tell
you is that she wrote it. It doesn't prove they were true, only that
she wrote it."
"It's not just the notebooks, it's everything. Angela called a while
ago today. Nick, my ex-boyfriend, was found dead yesterday."
Elizabeth started to cry.
"Oh Elizabeth. I'm so sorry. What happened?" Alex pulled
Elizabeth closer. Why did Elizabeth always get the rough end of
things? He wished that he could do more, even take on some of
the pain she was feeling herself.
"Someone murdered him. Stole his money and slit his throat.
Why would they do that? He hadn't hurt anyone except me, and
sure, I was mad at him. But this! I never wanted anything like this
to happen to him."
"It's a cliche, but bad things happen to good people, Elizabeth. It
sucks but it's true. Whatever happens, I'm here. No matter what
you do, where you go, or what you say to me, I'm here for you."
Alex turned Elizabeth's face towards him and gave her a kiss.
Elizabeth felt much better. Knowing that Alex was here for her
made all the difference. He was correct about the notebooks, but
so much didn't add up about this whole thing. The truth had to
be somewhere, and in spite of what had happened she was
determined to find it. Only one way remained -- she had to let
Deianeria take over for a while. Not yet though. She needed to
mourn a little for Nick and pacify her Mom and Dad. "Alex?"
"Yes"
Elizabeth cuddled Alex some more "I don't want to stay here
anymore. I want to go to New York. I have too little to do here,
it's driving me stir crazy. In any case I need more stuff ready for
next term. I was going to get them in London, but New York is
better. Please come with me."
"Inviting me off for a dirty holiday are we? I thought we'd take
things a step at a time," Alex joked.
Elizabeth didn't laugh. In the old days she would have slapped
him, but now she saw it for what it was, an attempt to cheer her
up. "Please Alex. I need you close."
Alex gave Elizabeth another kiss, "I'm there."
-- o -- o -- o --
"I hope you're not going because of us?" Matthew asked
Elizabeth. He'd been hurt by her announcement. It seemed to
him that she was disassociating herself from Kat and himself.
Elizabeth gave Matthew a big father-daughter hug, "Don't be
silly Dad. I need to get sorted out for next term and I can't do it
here in the middle of the Indian Ocean. Alex is coming too, so I'll
be ok. Really dad, all that business is over and done with."
"If you're sure you're ok then that's fine. We'll be over the first
week back to check you're ok." Matthew returned the hug. It had
been too long since she'd hugged him like this. He did wonder if
Elizabeth was play acting, but it felt genuine enough.
"Dad, I'm fine, really. I leave first thing in the morning. Alex is
flying over a couple of days later. Hey, I promise I won't trash
the place," Elizabeth smiled.
"We trust you," Matthew said. That was all he needed to say to
tell Elizabeth that she was on her own, that they would be there
for her if she needed, and that they still loved her.
Elizabeth got the message, "Thanks dad."
In spite of her early start the next morning Elizabeth woke at
2am. She gently opened her bedroom door and let her eyes
adjust to the semi darkness before creeping out of her room.
She knew what she wanted and where to get it. It took her a few
minutes to creep downstairs and open the door to her dad's
office. After gently lifting the carpet, she took a look at the safe
now nestling under it.
She tried the old combination of "072096" -- which was her
parents wedding anniversary -- but that didn't work. She quietly
swore. She now only had two chances left before the alarms
sounded. What else could it be? She tried her own birthday of
"052002" but the bleep told her it hadn't worked. Only one
chance remained and only one choice. Elizabeth closed her
eyes and within a few moments Deianeria opened her eyes.
That little miss priss Elizabeth had so nearly messed things up.
She needed those notebooks, as they were the only way she
could be free. Now think!
Elizabeth had tried the obvious one of anniversaries and
birthdays so it couldn't be that. What was another memorable
date that Matthew in a state of distress would think of? It would
have to have something to do with Elizabeth, as she would be
on his mind at the time. What event from Elizabeth's life would
stick in Matthew's mind apart from Elizabeth's birthday? In a
flash she had it! She had been thinking too much like Elizabeth
and it had nearly cost her the precious diaries! After reading the
diaries Matthew wouldn't be thinking about Elizabeth -- he would
be thinking about HER. So what date would Matthew most
remember about HER? Of course, the date he was supposed to
marry her. Now what was it?
Deianeria thought back to what she'd read about it. That was it.
She dialed "082493" and the safe swung open. In the back of
her mind she could hear Elizabeth telling her that her job was
over and it was time for her to take over once more.
"Not yet miss priss," Deianeria whispered to herself.
"I said now!" Elizabeth's voice told her.
"You need me to find the other useful stuff from the spare room.
If you leave them behind you'll never get them back!" Deianeria
whispered out loud.
Deianeria waited for a few moments. She hated being
subservient to Elizabeth but for the time being it was the only
way.
"Ok collect the stuff, then we go," Elizabeth's voice told her.
"Ok," Deianeria whispered back.
"One last thing. Did you have Nick killed?" Elizabeth's voice
sounded worried.
"Could I kill anyone? I AM part of you. Could you?" Deianeria
hissed.
"No. Sorry I asked. We'd better get a move on," Elizabeth
conceded.
Deianeria gave a wry smile. Elizabeth could be so naive
sometimes. After collecting the notebooks she shut the safe and
turned the dial back to what it had been set at. She was glad
Elizabeth had switched over to her. Elizabeth hadn't even
registered the old positions -- fortunately she saw everything
Elizabeth did and had made a note of it. It was now clear that
she could keep things from Elizabeth if she chose to and
therefore it would be logical if Elizabeth could too. However,
Elizabeth needed to share everything with her for the work to be
done. It gave her a lot of pleasure that it didn't go the other way
around.
Deianeria replaced the carpet and ensured that the crinkle was just
in the same place too. Elizabeth hadn't spotted that either! She
mentally sighed. Elizabeth was such an amateur. After closing
the door Deianeria crept upstairs and into the spare room.
Part of her wanted to retrieve her clothes but they would only
take up room she didn't have. The original notebooks had been
put back but they were useless to her. She suddenly had a
thought and moved over towards the pile of Matthew and Kat's
stuff. She had to take the risk of putting the light on, but as long
as she didn't make a noise it should be ok.
After switching the lights on Deianeria found a leather bound
folder and opened it up. It contained the account details of
Matthew and Kat prior to the year 2000. This ledger would be
invaluable in finding out if any financial irregularities took place.
Deianeria picked up the ledger and a few of Cathline's
notebooks and gently closing the door behind her went back to
Elizabeth's room.
Once again she heard Elizabeth's voice telling her to leave, but
she still had things to do. "Do you want to sleep on the plane or
let me work on these?" Deianeria answered back.
"It would be efficient to work on these on the plane. Once Alex
turns up it will be hard to do anything on this," Elizabeth
admitted.
"I like Alex. I hope he doesn't betray us," Deianeria stated.
"What's that supposed to mean?" Elizabeth said nervously.
"It'd blow the entire thing wide open wouldn't it. It's vital he
knows nothing of this until it's over," Deianeria said. Elizabeth
was getting nervous that much she could tell.
"Agreed," Elizabeth said.
"Are you going to fuck him when he arrives?" Deianeria asked.
"No. I want to wait," Elizabeth said determinedly. Kat had told
her how special it was to save yourself for the one you really
loved. How presenting yourself to him as a pure virgin was one
of the most precious gifts a woman could give.
"I think you should fuck him. So you know what's it's like. If I
were you I would just take him. Let him know who is boss,
dominate him. I would put my cunt in his face and make him lick
me out," Deianeria said seductively.
Deianeria reached down beneath her nightdress and felt herself
becoming moist and aroused at the thought of possessing and
dominating Alex. It had been too long since she'd felt like this.
Instinctively her finger went inside and caressed her clitoris and
a small whimper escaped from her mouth.
"Stop this!" Elizabeth demanded.
"Why? You know you want this as well. You know you want to
feel his warm cock inside you and feel him thrust in and out. You
know you can't wait to feel his cum inside you and that warm
afterglow that comes from orgasm," Deianeria crooned. She
was feeling jolts of pleasure as she moved her finger in and out
of her.
"Hmm that's nice," Elizabeth admitted.
"See, told you," Deianeria gasped. She had now laid herself on
the bed and was now fingering herself with both hands. The jolts
of pleasure were getting greater and more frequent and she
could feel herself nearly reaching climax. She rolled her
nightdress up to reveal her full firm breasts. She put a hand her
left breast and started to gently tease the nipple. Another wave
of pleasure rippled thru her. "This bit is private", she told
Elizabeth and closed down the conversation.
In her minds eye she visualized Alex, spread-eagled on the bed.
His hands bound by handcuffs and his legs spread apart by a
large iron spreader bar. Alex's cock was erect and waiting for
her to mount him. In Alex's mouth a ball gag stopped him from
saying anything. She stood over Alex and gently started kissing
his muscular thighs and slowly she teased herself so that her
mouth was just above his cock, "I'm not going to fuck you"
She heard herself say, "Because penetration means you have
some power over me. I'm going to do this instead!"
She bent down and put her mouth over Alex's throbbing cock.
She teased it with her tongue and gently sucked on it. She felt
Alex tense as she moved her mouth and tongue all over it and
she knew he was ready to come. Still caressing Alex's cock with
one hand. she picked up the small dagger from the side of the
bed and hid it behind her back. She moved back to sucking
Alex's cock and felt his body twitch as he started to come. She
quickly took her mouth away from Alex's cock and saw his cum
come pumping out. Alex lay back in the afterglow of orgasm
unable to move, powerless and bound. He tried to scream as he
saw Deianeria whip the dagger from behind her back but the
scream was stifled in his throat as Deianeria cut his neck open.
The image faded and Deianeria gave a loud moan as she
reached her own climax. Her minds eye showed a picture of
Alex's blood seeping out over the bed and in the midst of her
orgasm she was wiping it all over her breasts and into her cunt.
She gave another moan of pleasure as another orgasm hit and
this time the pleasure came not from her fondling of her pussy
or of the kill but from the thought that this is what she would do
to Alex if he dared to break her heart.
-- o -- o -- o --
Matthew was banging on the Elizabeth's bedroom door for a full
five minutes before Deianeria answered the door. "Hi dad,"
Deianeria said, her voice full of innocence.
"The chopper leaves in half and hour. You're normally up before
us. Are you ok?"
Deianeria wiped her hair away from her eyes, "Yeah fine. Sorry I
must have overslept. Gimmie a few minutes and I'll be back
down."
"Ok," Matthew said and shut the door.
Deianeria fumbled around in Elizabeth's bedside drawer and
found an E-mail waiting on Elizabeth's PDA.
"To ECSTEPHENS@Stephens.corp
From Professor Michael Cromwell Ph.D.
Elizabeth,
Thanks for your scans. They are very interesting both on a
technical and personal level. It seems as though the samples
from the workbook and the UV inked notebook are from the
same hand. The sample in the notebook written in ordinary
ink is from a different person. Of course it is possible
these entries are forged, but in my opinion this is only a
small possibilty."
Deianeria gave a smile. She had thought so. That was the only
thing that made sense. She now knew what was going on, but to
admit it to Elizabeth would mean that she would no longer be
required. This was something that Deianeria was determined to
avoid for as long as she could. Of course Elizabeth would see
the E-mail, but she would reach the wrong conclusions. She
would see to that.
She turned the PDA off and placed her bags outside the room.
The chopper pilot would pick them up for her. Turning round, she
went into the shower. It had been too long since she'd felt able
to release the sexual tension inside her, especially in the way
she liked it. Elizabeth had kept her body in good shape. That
much was clear as her hand went down over her firm breasts,
past her smooth flat stomach and onto her pussy. She resisted
the temptation to go there again. She needed to focus, not get
distracted by carnal pleasures.
A few minutes later she dried herself off and on a whim decided
to put on the bleeding heart outfit again. That was her favorite
so it ought to go with her. A thought struck her. Elizabeth hadn't
asked about the receipt. Should she do that now? Maybe not,
do it over the phone once the ledgers have been studied. That
way Matthew's answer could be verified against real figures.
Deianeria considered that the ledgers could hide or exclude any
payments for use in creating the fraud, but they would be hard to
cover up.
Time flew past and soon Deianeria had kissed everyone
goodbye and was on the plane to New York. Elizabeth's
nagging voice at the back of her mind reminded her that she
was supposed to be working, not enjoying the flight over.
"I need to relax. Now go away," Deianeria commented.
"I can and I will shut you down for good. Now get on with it. I
want this over and done with before I get back to Cambridge,"
Elizabeth complained.
"I've been thinking about that arrangement. Not good enough,"
Deianeria demanded.
"You haven't any choice in the matter. All I need to do is take my
Olanzapine again and you are gone," Elizabeth said back. Her
voice was sounding worried.
"When your parents gave you that Olanzapine injection it didn't
last very long did it? If you ask me, your body is gradually
building up a tolerance to the drug. In any case you need me
around," There, that will get her thinking, Deianeria thought.
"I guess. Why do I need you? I can call this whole thing off right
now and you'll be gone. It's got way, way out of track now. I
never used to be able to hear different voices in my mind,"
Elizabeth stated.
"Because I've worked out what's really going on," Deianeria
stated.
"How can you? You only have the same information as I have,"
Elizabeth called Deianeria's bluff.
"Because I can think and plan far beyond what you can do.
You've seen that all along. That's why you asked me to help. I
haven't yet worked out all the details, but one thing is for sure;
you need my protection," Deianeria stated.
"From whom and from what"
"From yourself and from becoming what you fear the most,"
Deianeria said cryptically.
"What do I fear the most?" Elizabeth demanded.
"Hurting the ones you love the most. Becoming like me."
Deianeria said it in a matter of fact way.
"So you do admit to being evil?" Elizabeth said. Deianeria
thought she sounded very worried.
"Evil is such a subjective term isn't it? I am that part of you that
gets the job done at any cost. I am the part of you that pushes
you beyond what you fear so that you can conquer that fear. I
am the part of you that drives your ambition. I am the part of you
that wants to make you grow into something you could not
normally be. If that is your definition of evil then call me it."
Deianeria's voice spoke in a soft comforting tone.
"You're that part of me?" Elizabeth queried.
Still in her soothing tone Deianeria said "That and more. Since
you freed me from your subconscious you have grown in so
many ways. Without me there would be no you and Alex, because you
would not have started to think of him in a serious way had I not
been around. I know how you feel about him. A part of you is
beginning to think he may be the one."
"I guess so. You leave Alex alone!" Elizabeth said defensively.
"You're welcome to him. I have no interest in him at all. It's my
further existence as part of your consciousness I'm after. In
return I will keep you safe. I give you my word."
There was silence for a few moments. Deianeria knew Elizabeth
was thinking but she couldn't tell what. If Elizabeth was thinking,
she would be now be confused, full of conflicting emotions
and doubt. This was of course what Deianeria was hoping for.
She had to live beyond the project, this wasn't just mind games;
it was a matter of survival!
Elizabeth asking "How can we both live together?" It's either you
or me in there?" interrupted her thoughts.
"All I want is your word that you will use me whenever you are
worried or concerned. That's what I'm here for? I'm here to
protect you." Deianeria crooned. She was winning the
argument. For now the project didn't matter. If what she thought
was going to happen actually happened then it would mean she
would never need prissy Elizabeth again. She would be gone
and only Deianeria would remain. For now her motives and
findings would remain secret. They would be revealed soon
enough.
Deianeria gave a smile as the naive Elizabeth said, "That's all?
You just want to be around waiting for me to call on you?"
"That's all I ever wanted Elizabeth," Deianeria said softly.
"OK, deal. Under one condition." Elizabeth stated.
"Which is?"
"Tell me what you've found out regarding the project,"
"Done," Deianeria said.
Deianeria opened her eyes. Thankfully she hadn't made a slip
and spoken out loud. That would have concerned a few
people! There was one last thing she needed to clear up.
"Elizabeth?" Deianeria asked in her mind.
"Yes?"
I need to do some more reading before I can finally tell you the
results. Can I stay until tomorrow morning? After that I'll be there
waiting for your call?"
"Ok. I will take over at 9am tomorrow," Elizabeth stated.
Deianeria closed her eyes and went to sleep. It was going to be
a long flight.
-- o -- o -- o --
Several hours later Deianeria landed at JFK airport feeling
utterly exhausted. She had known before she had taken off
what she was going to do and say, but it had worked out just the
way she wanted. Goody two shoes Elizabeth had fallen right
into her trap. She was so, so trusting and in a few months time
she would pay the penalty. As she had told Elizabeth she was
the part of her that would achieve the goal no matter the cost.
She would also keep her side of the promise. She would keep
Elizabeth safe, but only her body. All she had to do was play a
waiting game and the person called Elizabeth Cathline
Stephens would be no more. Sure her body would still be there.
Deianeria needed it. However the personality would be gone,
replaced only with Deianeria.
Deianeria felt elated. Only a few more months of being a
prisoner, of having to deceive and skulk in the shadows of the
mind. Patience was a virtue and Deianeria had that in spades.
After collecting her bags from reclaim she hailed a cab and an
hour or so was letting herself into Matthew and Kat's Manhattan
apartment. She so wanted to go to sleep but she wanted to
make the most of this time of freedom. This would be her last
chance for a while.
Going into her bedroom she closed the curtains and she
stripped off her clothes and admired her naked body in the full
length mirror. She had to admit Elizabeth had kept it in pretty
good condition but there was still room for improvement. Her
arm muscles were a little weak looking and her thighs could do
with some firming up.
What would she miss the most in her months of Exile? Eating
was overrated as was Elizabeth's relationship with Alex.
Elizabeth had no idea how to get the most out of Alex for her
own pleasure. She had these out of date romantic ideas of
giving herself to him. Elizabeth was welcome to them, they only
had a few months left anyway. After that Deianeria would show
Alex the real meaning of sex and relationships. A single night
with her then Alex would be her slave forever. Unless of course
he decided to run, and Deianeria already knew she would do in
that event.
It was the glow of orgasm, of sexual pleasure she decided she
would miss the most in the coming months. Her body gave a
quiver of anticipation of the pleasure to come. She was about to
run her hand over her breast, when a thought occurred to her.
Angela was a threat to her future plans with Alex. Elizabeth had
noticed how she had eyed him up when they had first met.
Would Angela need to be dealt with as well?
Only if Alex and her became an item; but by then it would be too
late. Therefore Angela's fate would match Alex's; it was the only
way to preserve herself. Deianeria had a wicked idea, it was one
that turned her on as much as the idea she'd had for Alex. Her
hand reached down, and stroked the soft hair between her legs.
Her fingers gently touched the lips of her vagina, and she gave
a soft moan. Her other hand cupped her breast and the fingers
ran little circles around her nipple.
Deianeria closed her eyes and imagined herself in a darkened
room. The lights were dimmed and in one corner a figure stood
against the wall. As she moved closer she saw Angela chained
hand and foot to the wall. Wrapped around her body were
several straps which had been fastened tightly, preventing
Angela from moving. Angela's legs had been spread out to form
an upside down Y shape. Deianeria saw with pleasure that
Angela's pussy was exposed and waiting.
Angela was wearing a black silky teddy and black nylon garters.
Deianeria gave an appreciative glance up and down Angela's
smooth, firm body. She moved in closer and gently stroked
Angela's nylon covered breast.
"Elizabeth, stop it. Why am I here?" Angela gasped. Her eyes
wide with fear.
Deianeria felt herself go moist as her fingers entered her. In her
minds eye she reached over and kissed Angela full on the lips.
Angela struggled to resist her but she was bound too tightly.
Deianeria forced Angela's mouth open with her hand and her
mouth and she felt Angela try and pull herself away. "I am going
to take you now, bitch!" Deianeria whispered in Angela's ear.
Angela gave a scream as she felt Deianeria's finger stroke her
exposed pussy. "That right scream, bitch!" Deianeria cursed at
Angela and proceeded to push her finger upwards so that it was
right against Angela's cervix.
"No please. Elizabeth, no" Angela was sobbing.
Deianeria pushed the helpless Angela against the wall and used
one hand to reach down underneath her teddy and fondle
Angela's breast. With her other hand she once again fondled the
lips of Angela's vagina. To her surprise she found them moist
and waiting. "That's more like it, Bitch!" Deianeria said.
"My God, no," Angela was calling out and her calls only served
to make Deianeria more aroused.
Still caressing Angela's breast and pussy, Deianeria moved in to
kiss Angela once more. Angela by now had resigned herself to
being raped by what looked like Elizabeth. But somehow this
Elizabeth was far different to the one she knew. That didn't
matter now as the new Elizabeth forced her tongue down her
throat.
Deianeria let the image fade for a few moments and moved her
other hand down to her pussy. By now it was dripping wet and
every stroke made her gasp with pleasure. She felt herself
nearing climax and instantly she was back with Angela once
more.
"Wait there bitch," Deianeria ordered and moved away from a
relieved looking Angela. She returned a few moments later
clutching something in her hand. Angela couldn't make out what
it was and it was all she could do to scream as she felt
Deianeria ram her clenched fist inside her.
Deianeria gave a gasp of pleasure as she gently rotated her
hand inside Angela. She found what she was looking for, a
small button on the side of the metal object she had held in her
hand. As Deianeria felt herself come she pressed the button
and waves of pleasure crashed over her as she heard Angela
scream. Ignoring the blood now pouring out over her hand
Deianeria rammed the now open flick knife up into Angela's
cervix and womb and gave it a twist before pulling her hand out.
Angela was now screaming in agony, all thoughts of being
violated gone as soon as she had felt the searing blade go right
into her. Just before she passed out she saw Elizabeth fondling
herself with her bloodied fist.
Deianeria stood and watched Angela slowly die as the bleeding
continued. With Angela's final breath Deianeria came and
couldn't help but scream with pleasure as orgasm after orgasm
came crashing over her.
Deianeria opened her eyes, exhausted by the pleasure she'd
felt. That was worth it. Over the next few months she would
remember this feeling and how it would soon come to pass in
the real world as it had in her own.
-- o -- o -- o --
"Time to wake up," Elizabeth chirped to a still sleeping
Deianeria.
Deianeria opened her eyes and checked the time. It was eight
forty. "I still have twenty minutes left," She reminded Elizabeth
and closed her eyes again.
"Yes but you promised to tell me what you've found out."
Elizabeth demanded.
"Yes I did. Are you sitting comfortably? Then I'll begin.
"Very funny," Elizabeth commented.
"Ok, first things first. The receipt is a fake. The signature is
forged, it's a very good one but it's the only way that fits. The
DNA test was easy to fake, as all it would take is a small hair
from your dad and simple chemistry to produce a positive DNA
test. How do I know this? Easy. Your dad didn't have fifty grand
to spend on surgery, neither dad Kat or Cathline. Their bank
account details show no sign of the money either being
transferred or laundered."
"Why?" Elizabeth started to say.
"Not yet! Questions at the end. Your research was quite correct
that using current theory and techniques DNA modification is
impossible. What it doesn't take into account is the brilliance of
Dr Bexley and her research team. She may not look it, or talk
like it but Cathline is one clever bitch. I've been reading what
records remain from TGEN. She was Watson to Dr Bexley's
Holmes. There can be no doubt that they stumbled on
something the world has now lost or not reached yet. Just
because we don't know how to do it now doesn't mean that we
never knew how to do it. I'm sure given time together we could
do the same as Dr Bexley did."
"I thought as much," Elizabeth commented. "But there's no
physical evidence of it ever having been achieved. Only
people's testimonies exist and they all may well have an interest
in covering it up. Everything's been classified as top secret."
"You forgot. There is evidence," Deianeria stated.
"Where?"
"In Syria. Remember Salah. He was turned into a replica of the
half woman-half tiger creature that Kat was in order so that Kat
could take his place. His parents had his body exhumed fifteen
years ago and taken back to Syria for re-burial. If his skeleton
showed extensive modification then that would be proof wouldn't
it?"
"Damn, Missed that one," Elizabeth swore.
"That's why I'm here. Now you see why you need me,"
Deianeria comforted.
"But his parents would never consent.." Elizabeth started.
"I have that one all in hand. It will take a while to get the
paperwork and their consent thru but in a few months time we
will know one way or the other and the Children of Bexley cult
will be gone. They will not be able to refute this evidence
against them and so they will fold," Deianeria said triumphantly.
What she hid from Elizabeth was the thought that in a few
months there would be no Elizabeth around to enjoy it.
"You are so right Deianeria. You've done brilliantly. But what if
Salah's body melted like the other changelings did when they
died?"
"Dr Bexley only told Hassan he had installed a changeling organ
in Salah. She was probably lying, why waste the effort if he was
only to be killed. Besides Matthew needed to believe that Kat
was dead, he couldn't do that if the body dissolved within a few
moments. No, I am sure we will find all the answers in Salah's
remains.
"What about the diaries. The handwriting matches and I suspect
the DNA tests will as well," Elizabeth stated.
"I'm nearly at the end of that one but I can find no record of Dr
Bexley ever visiting Tibet. I suspect they may be forged too.
Placed there to distract you," Deianeria explained. It felt good to
treat Elizabeth like a bright pupil with no hope of matching the
teacher.
"By whom and for what."
"It's obvious isn't it. The Children of Bexley want to alienate you
from your family so that you will join them. The receipt and the
misdirection has to lead to that conclusion. It's the only one that
fits," That's not all they are after Deianeria thought but kept it to
herself.
"They think I can be the new Dr Bexley?" Elizabeth stated. She
sounded worried.
"Very good little one," Deianeria said. Maybe she wasn't as
dumb as Deianeria gave her credit for
"That's why you want to protect me. You want to stop them!"
Elizabeth sounded hopeful.
"Got it in one. I'm the only one who can. I hope you see that
now," Deianeria said as soothingly as she could under the
circumstances.
"Oh Deianeria thank you. I knew you wouldn't let me down. I
was wrong to distrust you. I'm sorry," Elizabeth apologized.
"That's ok. My time is nearly up and you need to get on with
your life. I'll be here, waiting for your call. Don't worry you won't
turn out like her. I promise it," 'That's because you won't be
around to turn out like that' Deianeria thought to herself.
"Thank you Deianeria," Elizabeth said softly.
"Listen. You have nothing to fear from the past. Alex is here for
you now. Put this project behind you and we'll move on
together. Goodbye now," Deianeria said soothingly.
Elizabeth gave a yawn and opened her eyes. She felt a great
sigh of relief. She hadn't been deceived by her parents or by
Cathline. They did love her, they weren't killers and furthermore
with Deianeria's help she now had nothing to worry about. She
could get on with falling in love with Alex safe in the knowledge
that her future was assured.
-- o -- o -- o --
Mark looked at the E-Mail in disbelief. No matter how many
times he read it, it said the same. He had failed the last set of
coursework and exams. If he didn't pass the retest in two weeks
time then he would be kicked out and that meant unemployable
and broke.
He decided he'd spend less time fawning over women he
couldn't possibly have and more time studying. If he did that he
might just stand a chance of passing the course.
The college had told him in the email where he was weak, so he
set about studying those areas. Two weeks was no time in
which to prepare, but it was all the time he had. His parents had
bawled him out about working harder, spending less time
partying with Wills, all the usual disappointed parental
speeches, and much to his chagrin they were right. He was
most upset at himself, he knew he could do better. He knew he
was one of the brightest in his class but he just could never
seem to find the time to study. Things had to change. In a
weeks time he would be back at college and by his reckoning
Anne Baxter would be back. Fresh from her adventures on the
high seas, and he just knew that she would distract him as soon
as he saw her.
His only chance would be to lock himself in his room after
tutorials and work. Wills would understand, and as for Anne
Baxter well she would just have to be such a babe and keep out
of his way.
-- o -- o -- o --
Anne Baxter flopped down on her bed in the women's dorm. It
was a week before the majority of the other students came back
but she really didn't have any other place to go. Besides, it gave
her chance to settle in after a long few months in Israel. She
reflected back on her time there. On the whole she had enjoyed
it but it had been soured by the tragic death of Steve. Her
findings afterwards had helped to end things on a positive note
but one thing she was sure of. It would be a hard fight to get her
theories and ideas accepted by the scientific community.
She had had her final grades thru from Tel-Aviv and as she
expected she had averaged 98.9% in every exam and
coursework. Her reputation as a 'rising star' was now assured.
That could only help matters when the time came.
In the meantime she had another couple of semesters here,
even though she had done enough already to be assured a
Ph.D. She only knew of one person who had passed a Ph.D. in
less than two years and with two semesters to go but that had
been in genetics and medicine and nearly thirty years ago. Dr
Anne Baxter had a nice ring to it. She could leave now and be
assured of that title but she had no desire to. She had too much
to do and her dissertation to publish.
The flight over had been a long one and she was very tired.
Tomorrow was only a few hours away and she still had to
unpack. She closed her eyes and memories of her time in Tel-
Aviv came flooding back.
The plaques on the walls of every building dedicated to those
who had died still had an effect on her. Men, Women and
children had all been killed in that one fateful morning. It had
triggered off a series of events that even now where trying to
work themselves out.
The joy she felt as the "Anna Maria" set sail on its research
mission. Steve had been an unknown then, aloof yet good
humored. She remembered watching the harbor move slowly
out of sight as they went further and further out to sea until land
was but a distant speck on the horizon.
Her first dive gave her immense pleasure. It had been her first
time using re-breathers and the freedom they gave her left her
addicted for more. She had so wanted to see the sea life in all
it's glory but empty sea greeted her on many occasions. The
results of pollution and over fishing were having a catastrophic
effect. In some cases she found it hard to tell she wasn't
swimming in a pool, sometimes, so empty was the water. When
she did find abundant life she never wanted to come up again.
The day she'd had her idea and it had been confirmed in theory
came back to her. Steve had been staggered by its audacity
and stunned by its genius. Seeing the once aloof Steve melt into
gushy admiration had given her a great deal of pleasure. That
had been the day when they really started to hit it off.
Anne felt a cold twinge on her leg. It was as though she had
bumped into Steve's body all over again. That was the low point,
her lowest ebb for many years. Death seemed to follow her
around, wait until she had dropped her guard, and then strike at
those she had started to love and care for. Her swim to shore,
dragging Steve's body behind her came into her mind. Why had
she done something as stupid as that? The reason was simple,
because she could.
Her victory over the Dean in getting re-assigned to the "Esau"
gave her pleasure. That had been fun, from becoming an
outcast to the most respected member of the crew in a scant
two weeks was something of a triumph. The last month had
been spent writing her dissertation, which was due to be
published in a few months, and now here she was, alone again.
In times likes these, when she was feeling tired and alone, she
would just remember back to her childhood, and of the gleeful
innocence of being a young girl. In her minds eye she saw
herself, tiny and frail dressed in a blue and pink dress looking up
in awe as they walked back from church one bright Sunday
morning. She was a real daddy's girl at heart.
"Daddy, when I'm older I want to do what you do," she
remembered saying. She must have been about five at the time.
"You'll have to work really hard to be a doctor," her father had
told her.
"I don't need to work hard -- I'm clever!" She had stated with the
absolute certainty that only a child can muster.
"That you are. But you still need to work hard. You know what
the most important thing about being a doctor is?" Her father
had bent down and was speaking to her face to face
"No," she had whispered.
"Every life is unique and precious," Her father said.
"Like mommy's jewelry?" she had asked.
Her father gave a smile, "Just like mom's jewelry."
The image faded and it saddened Anne to think on it. How far
she had come from that little girl looking up to her seemingly all
knowing and all powerful father. Her love for him hadn't been
able to save him that fateful night when the car he and her mom
crashed while rushing to see her, had it?
There was so much she wanted to say to them. She knew they
would be proud of her now, making a new life for herself, but
what of the things she had done in order to get here? In the end
that mattered little. She was who she was and where she was.
No amount of reminiscing could alter that fact, and in a way it
gave her the comfort she so desperately needed.
-- o -- o -- o --
The next two weeks were a nightmare for Mark. He had spent
every waking hour studying in preparation for today, the day of
his retest. Today would decide if he would be allowed to stay or
would be drummed out in shame and failure. Wills had been
shooed away and he lived, breathed and ate the topics of the
exam. He didn't recall working this hard on anything in his entire
life. He HAD to pass this course. As the old cliche went, failure
was not an option.
He packed his bag, ready to drive to the room where the exam
was to be taken. He wasn't allowed to take his PDA in, so he left
it by the side of his bed. All he would be allowed to take in was
himself, and some pens with which to write notes. He would
speak the answers into the computer supplied, and it would then
do the rest. He double checked the contents of his bag, uttered
a silent prayer and went outside.
After rummaging around in his pockets and bag, he realized he
had left his car keys behind and shot off back to his dorm to find
them. After frantically searching around, he found them in an old
pair of jeans. Breathing a huge sigh of relief, he closed the door
and ran back to his car and after a couple of attempts started
the car. At least that bit was working well. Mark's car was an old
1980's chevy. His friends called it antique, which it was and
since the cost of gasoline had broken the ten dollars a gallon
mark last year it was an expensive antique. The cost for Mark to
change it to a newer fuel cell powered model was more than he
could afford and gas prices being what they were he only used
to for essential trips.
He had only just gotten round a sharp left handed corner when
the car suddenly died on him and spluttered to a halt. Swearing
violently he slammed his fist onto the steering wheel. He looked
around for anyone who might help him, but no one was around.
He checked his watch; he had twenty minutes to go before the
exam started. This was typical, just fucking typical.
He popped the hood open and looked inside. There was no oil
or smoke billowing out so things looked ok from that angle. He
checked under the car but again there was no fluid leaking out.
He checked the battery connections but they seemed fine, as
did the spark plugs.
He heard a deep rumble in the distance. Actually it was more
like a throaty roar of an engine. He looked up to see the outline
of a silver Porsche take the corner he had just gone round with
consummate ease. It just clipped the apex of the bend, and
sailed around it as though on rails. Whoever it was, was a
skilled driver.
-- o -- o -- o --
Anne Baxter was relishing being back in her Porsche
convertible. Months of driving boring modern cars with silent fuel
cells and biometric sensors had robbed her of the feeling of
power and domination that she felt while driving her Porsche.
Although it wasn't her pride and joy, flew in the face of sound
environmental doctrine she did have a soft spot for it. Everyone
needs a harmless vice, and this car was hers!
She had just taken it out for an early morning run in the twisty
roads, a few miles from her dorm. Before she had left she had
upgraded it with the latest in anti-speed trap countermeasures,
so she felt free to drive the car as it was supposed to be driven.
There was a particular sequence of bends she had got just right,
kissing the apex on each corner allowing the car to just feel it's
way around each bend as if it were dancing. Even her favorite
straight section was empty of traffic so she had allowed her
speed to creep up to an indicated 170. Creep wasn't the
adjective she would describe it as, more like being hitting in the
rear by a train. For sure, they didn't make fuel cell cars like this
yet.
Her hair was all blown about by the force of the wind, it would
need a wash before she went out again. She could feel her
cheeks flush with the cool morning air. She was back into town
now. All thoughts of high speed behind her as she cruised back
to her dorm. As she rounded a bend she noticed an ancient
chevvy, just like the one her dad used to have. It had the hood
up and a man had his head inside the engine.
As she drew closer the man lifted his head of the engine bay
and stared. He was obviously distressed about something, and
she could see the start of a puppy dog look as he saw her drive
closer. On impulse she decided she would stop to help, it would
be her good deed for the day.
-- o -- o -- o --
As the Porsche drew closer, Mark managed to catch a glimpse
of its occupant. It was Anne Baxter! That was all he needed.
Late for an exam, covered in grease from trying to fix the car,
and now his dream girl turns up to ruin his concentration. She
was slowing down. What the hell was she doing?
Mark had to try and stop his jaw from dropping, and his eyes
from popping out of his skull as she drew along side him. Her
hair was a mess, but even then she looked as heavenly as she
had done since he'd first caught a glimpse of her all those
months ago.
"You ok?" she asked.
Mark's reply was lost in the back of his throat. He dare not say
anything in case it made him seem foolish.
She gave him an odd look, and then asked "Vous-etes bien?,
Es usted aceptable? Sind Sie okay?"
Now Mark was even more nervous, she could speak at least
three languages! All he managed to do was point at the car and
say "car"
Anne gave a Mark the kind of look that implied his IQ was a little
less than a turnip. She was about to drive off, when Mark in
sheer desperation at seeing his dream woman leave forever
said, "Sorry. I have the retake of my exam in fifteen minutes and
my damned car has broken down. What a lousy day!"
Anne broke into a wide smile that caused Mark's heart to melt.
She decided that Mark was just stressed about his exam, and
that he wasn't going to harm her or anything, so she got out of
her car.
"My dad used to have one of these," she said, noting that Mark's
jaw was on the floor and his eyes were taking in her every
curve. The thought pleased her. He was kinda cute in a boy
next door sort of way. He reminded her of someone she had
been close to so many years ago.
"Did he?" Mark asked. What a dumb answer he thought.
Anne walked over to Mark's car and peered in," Yeah it used to
do this all the time. The wire connecting the ignition to the
distributor used to slip out all the time. They look firmly
connected, but they're not. Here let me show you," Anne pushed
the four leads firmly into the distributor cap and then gave them
a shove for good measure, " See you need to push until you feel
them click back into place. Now try it."
Mark dashed back into the car and turned the engine. To his
amazement it started first time. "You don't know how much this
means to me. Thank you. He checked his watch there was ten
minutes to go but he would make it, just!"
Feeling elated that he wasn't going to fail just yet Mark blurted
out, "I want to say thank you properly. Dinner at eight? Meet me
outside the science faculty?"
Anne gave a smile. He was such an odd fellow. The similarities
between rescuing this young man and the last man she'd helped
whose car had broken down were not lost on her. Why not,
second time lucky? "Sure. If you don't mind we'll take my car.
Yours might not make it."
Mark was so surprised with her answer that he stalled the car.
-- o -- o -- o --
Elizabeth had arranged to meet Angela for lunch, and as usual
Angela was running late. She checked her watch once more in
frustration. She had a tutorial in half an hour, which didn't leave
much time for lunch and a chat. Elizabeth was pleased that
Deianeria had taken a back seat. In fact since she'd started
back on the Olanzapine Deianeria had remained silent. It had
been worthwhile running the simulation, even though it had
gotten really spooky towards the end. Deianeria's revelation that
the Children of Bexley were out to recruit her was, on the face of
it not a surprise at all. What a coup that would be for them if they
managed it. Well not any more they wouldn't!
She had told Angela the whole thing, except from the details of
the deal she'd struck with Deianeria and about Deianeria
herself. That would worry Angela too much. Angela had thought
Deianeria's conclusions very logical and had promised to look
out for her as well. So all in all no harm was done.
Alex was due to visit in a week or so. In spite of settling back
into college life again, she found that she was missing him
already. It was still a puzzle for her how she could miss
someone she had spent years wanting as far away as possible
after only dating them for two weeks. However, the fact
remained that she now had an Alex shaped hole in her life.
When she had told Angela about Alex she was delighted for her.
When Elizabeth told her about their first date Angela went green
with envy. Not only about the location but about Alex too. She
was right, he was a prize catch. "Damn I knew I should've asked
him out first!" Angela had commented.
The hardest thing Angela and herself had, had to do was to
write to Nick's parents saying how sorry they were. The brutal
way in which he had been killed had sent a shock wave thru the
university, which was only now abating. Another shock for
Elizabeth was to see that, unknown to her fifty thousand dollars
had been transferred from her account, seemingly by herself!
That must have been Deianeria! But what did she need the
money for?
Deianeria's activities whilst occupying her conscious mind,
concerned her. Sure, she had indulged in a little 'two hand
touch' before but Deianeria's had a dark, sinister edge to it. In
her dreams she had vague pictures of raping and killing people
she loved and cared for, but these were only a hazy recollection.
She dismissed them as bad dreams. Another thing, why had
Deianeria found it necessary to shut her out? The very act of
becoming Deianeria confused her too. It was as though
Deianeria thought her body was her own and not Elizabeth's,
whatever happened to it happened to her. Still, it was a moot
point now. Deianeria was safely contained, and where the hell
was Angela?
She felt a tap on her shoulder and she whirled around, "Angela
Hi. Where have you been?"
"I took forever at the dentist, and there was one hell of a queue
at the drug store. Anyway I've got your 'asthma' medicine for
you. I'm starved," Angela replied, breathlessly.
"Thanks for doing that for us. We should still have time for a
sandwich before I need to go," Elizabeth took the small white
box from Angela and put it in her pocket. Angela had played
along with the Asthma medicine deception since she had first
known the truth.
"Still missing him?" Angela asked.
Elizabeth nodded, "Yep."
"Damn," Angela smiled.
-- o -- o -- o --
"Will's you'll never guess what!" Mark said running into Will's
dorm.
"Who are you?" Wills asked with a smile.
"I've got a date!" Mark exclaimed.
"Who with? Lemme guess. Doris the cleaner!" Wills teased.
"With her! Anne Baxter!" Mark could hardly believe he was
saying it, and even less that it was true.
"How come? You drug her or something?" Wills commented.
Mark couldn't contain his excitement. "You know I had my retest
today. It was a nightmare of a morning. I was as nervous as hell
and to cap it all, my car broke down on the way there. There I
was stranded with nowhere to go but flunk city, when who turn's
up in her Porsche. She knew exactly what to do to fix the car,
and then when I asked her out as a thank you she said yes. It's
tonight at eight!"
"She probably has a thing about men in broken down cars,"
Wills commented.
"I don't care. I'm dating Anne Baxter! Uber babe! I never thought
there was god until now,"
"Never mind Uber babes how'd the exam go?" Wills asked.
Mark was too wrapped up in his thoughts to answer.
-- o -- o -- o --
As Anne walked up to the science faculty she wondered what
the hell she doing going out with a guy she'd met on the side of
the road. Still he seemed ok. She'd ran a check on his car's
license plate. His name was Mark Andrews and he was a
student studying ecology at the same college as she was. He
had been brought up in Iowa and had been here ever since. He
had no criminal record and was otherwise just a normal guy.
He had seemed abnormally enamoured with her though. She
wondered if she didn't have her own stalker and he was it. Oh
well, she would find out soon enough. He was cute though, and
maybe she was a sucker for helpless men. It had taken Steve
weeks to pluck up courage to ask her out, and she'd only just
said yes. So why did she agree to this guy? Maybe it was
because he was just a name, if anything did happen to him, he
was just a name, and that she decided was the way she wanted
it to be.
She checked her watch, it read 7:59. Time to go. She had
decided that casual was the way to go. Therefore, she had
chosen her second best pair of skirt-pants, black shoes and a
green blouse. Wrapping her hair up into a pony tail she made
her way to the science faculty.
-- o -- o -- o --
"I hope this isn't going to be one of those flowers, restaurant and
awkward moments when it's time to drop me off kinda date,"
Anne had stated mischievously. She had noticed Mark holding a
bunch of mixed flowers as she walked up to him.
Mark looked dismayed, "Actually, these are for you," he said
offering them to her.
Anne gave him a devastating smile, "Only teasing. How'd the
exam go?" She took the flowers from him and held them under
her arm.
Mark relaxed. He thought he'd blown it right away, but Anne
joking with him had broken the ice and calmed his nerves.
"Much better. It helps studying rather than mooching around."
Anne nodded, "That's the idea. My car's just around the corner
So where are we going?"
Mark put a finger to his lips, and shook his head, "Wait and
see."
"Aha one of those flowers, wait and see, and then awkward
moments when it's time for me to go kinda dates," Anne gave
Mark another heart melting smile.
Mark didn't really know what to reply. Was Anne mocking him,
or was she trying to ease his nerves? "You go on a lot of
dates?" He asked.
"Only with men who's cars have broken down," Anne said, with
a grin.
-- o -- o -- o --
"If you park just over to the right there we can walk the rest of
the way," Mark stated, gesturing to a small parking place about
a hundred feet to the left.
"So it's a walk along the shore then," Anne commented. She
was surprised how well she and Mark were getting on. He had
responded in just the right way to her teasing, and had seemed
to conquer his nerves that had threatened to mar the evening.
"Not just a walk along the shore. We need to eat as well
remember, " Mark said. Anne was turning out to be as classy,
witty, and beautiful as he had dreamed of. It wasn't every day
that dreams turn out to be the same as reality, but today was
one of those days.
"I don't recall any restaurants along here, unless of course you
want us to walk 5 miles," Anne said. Whatever Mark had
planned she knew she could cope with.
Mark gestured that they should walk down the long pathway
onto the beach, "In about half an hour dinner will come to us!"
He said, cryptically.
"Good I'm starved. As long as it's not sushi, when I was in Asia I
ate nothing but sushi, got sick of it. Anyway, what part of
ecology are you doing? Marine? Arboreal? Zoological?"
Mark raised an eyebrow. She wanted to talk shop. "Dunno yet.
All of them I guess. You can't pick one without looking at the
other. "
Anne nodded "True. Part of my time in Israel was spent looking
at the marine ecology of the Med. It's such an enclosed space,
it's an excellent barometer as to how things are going to
eventually fail unless I stop it,"
Mark noticed the use of the word I. That was either supreme
ego or she had found something. Anne didn't seem the
egotistical sort, so it had to be the latter, "I?"
Anne gave Mark a wry smile, "Good try. I have an idea that's all.
When I publish it'll be headline news."
"This looks about right," Mark gestured to an open stretch of
sand just above the high water mark. He found a large, smooth
stone and sat down beside it. He lifted it up and pulled out a
large plastic bag. Opening the bag he pulled out several
unopened bottles of beer and a bottle opener.
"Strange how people just leave food everywhere isn't it?" Anne
commented and sat down beside Mark. The beer under the
stone had been a nice touch. She took a bottle from Mark, as he
offered it to her.
Mark decided that now was a good time to bring it up. He was
desperate to know. "I'm sorry to hear about the boat accident. It
must have been terrible."
Anne nodded. "Yeah it was. Poor Steve, never had a chance.
That was the kind of celebrity status I didn't need"
"Sorry I asked. It was insensitive of me," Mark said. His heart
sank. He had blown it again.
"That's ok. I now have to make sure I don't let his memory
down. If anything, it's given me more impetus to finish the work
we were doing. I had to go head to head with the Dean to get
myself back on another boat."
Mark smiled, "That must have been fun."
Anne grinned, "yes it was," and she related the story of how
she'd 'persuaded' the Dean to get her on board the 'Easu'
After the story was told Mark shook his head in disbelief "You
said that!"
"And more," Anne said, taking another swig of beer.
Mark plucked up courage to say "You really are the most
remarkable woman I've ever met. "
Anne raised an eyebrow, "How so?"
"Apart from rivaling Rachel Martin,"
Anne gave a smile. "Why thank you."
"You act with supreme confidence. Nothing fazes you, it's
though you own the world. You don't do you?"
"Do I look like Jennifer Gates? I hope I look better than Queen
Britanny?" Anne commented.
"Thankfully no and you look a lot better than her!" Mark grinned.
"I guess it comes from having no parent's for much of your life.
You either become bitter and resentful or you pick yourself up
and make it on your own. I did the former, then came to my
senses, and then did the latter," Anne said softly. Why was she
opening up to Mark? Maybe, he just made her feel human
again.
"I'm sorry. It must have been tough, "Mark said softly.
Anne paused for a moment, looking out at the sea. As if her
heart was now lost in the midst of a million memories, "It is.
Everyday I move a little further from who I was to who I want to
be, but there are some hurts that time can't wipe away."
Mark couldn't recall seeing Anne looking so vulnerable. "Can I
help?" He offered.
"I'm bad news Mark. Trust me, I'm more trouble than you can
handle, more than anyone can," Anne said, still looking out to
sea.
"How can you be? You don't even know me," Mark said. His
dreams were slipping away fast. Was she going to leave him
even before dinner?
"Yes I do. Country boy, setting out to the big city to make a new
life for himself. I fell in love with a country boy like you once. He
nearly didn't survive the encounter," Anne said quietly.
Mark looked at Anne's face and was amazed to see tears in her
eyes. She was hurting inside and Mark wanted, no wished that
he could take her pain away, "I don't care. You don't know me.
I'm not this country boy you met once. I'm me!"
Anne turned to face him, her eyes full of sadness and despair,
"You do not understand."
On impulse Mark took hold of Anne's hand "Then make me
understand. I'll ask again what can I do to help?"
Anne was debating to leave or not but decided at the last
moment to stay, "Dinner would be a start," she politely withdrew
her hand from Mark's. It had been a nice gesture but was now
obsolete.
Mark checked his watch, "He should be here by now"
"Who should?"
"Bernito."
"That explains everything," Anne commented.
"Bernito makes the best hot dogs in the state. I've no idea what
he puts in his relish but it's unreal," Mark said.
Anne gave Mark a look that said 'You dragged me all the way
out here just for beer and hot dogs?'
Mark didn't need Anne to say it. He knew what she was thinking.
But what was he thinking of; hot dogs and beer for God's sake!
He should have blown his allowance on the most expensive
restaurant in town.
Anne saw Mark's glum look and burst out laughing. "Maybe I
was wrong about you."
Mark felt hurt. More than hurt, cut to the core of his being. "I'm
sorry I was wrong about you," he said softly. How could he have
been so wrong? Anne Baxter, Uber babe! Yeah right! Uber Bitch
more like!
"No you weren't. I told you I'm trouble!" Anne said.
"And I'm just a country boy," Mark complained bitterly.
"Come here country boy," Anne said and to Mark's
astonishment pulled him close and kissed him.
Mark was so startled he almost forgot to kiss her back.
-- o -- o -- o --
"Hmm what is in these hot dogs!" Anne exclaimed. The taste of
the relish was nothing like she'd had before. Sure, some chili
and tomato were in there, but she could only hazard a guess at
the rest.
"Told you they were good," Mark said. He was still reeling for
the shock of Anne kissing him.
"You're wanting to know why I kissed you, and will I do it
again?" Anne commented.
"I had wondered," Mark admitted. Once again Anne had shown
this habit of putting him off balance. Did she do that to
everyone?
"Because you're you. I mean you could have taken me out to
the most expensive place in town. Even though I knew it'd make
you broke for a week. I've seen your car remember. You could
have treated me like a princess; showered me with gifts in order
to try and win me over, but you didn't. Tonight you showed me
the real you. Not some false made up image, but the real Mark
Andrews. This age of ours concentrates so much on what is
image, what is false, it's wonderful to meet someone who's the
opposite."
"I didn't plan it that way. This was all I could afford," Mark
admitted.
Anne gave a smile. She was a little mystified as to why she'd
kissed him as well. It seemed the right thing to do. She had
found, much to her surprise that when she was with him her
world weary cynicism melted away. It was though she was
looking at things thru rose tinted glasses, that the past didn't
matter, and that people or at least Mark Andrews felt trusting
enough of her not to put up barriers. "I've told you what I'm like.
More trouble than you can handle."
Mark was about to say 'Wanna bet?' but changed his mind at
the last moment "You're probably right." He admitted
"But that's something I would like to be proved wrong on," Anne
said softly.
-- o -- o -- o --
The next three weeks passed in a blur. He had seen Anne most
days after classes, and it seemed that every day that passed,
they had grown closer. Anne still remained secretive and
mysterious about her past, so Mark avoided the subject. She
would tell him when she was ready. So far he had seen little of
the 'bad news' that Anne had warned him of, only that Anne was
everything he had dreamed of and more.
For Anne's part she was rapidly warming to her 'country boy'.
Mark was incredibly laid back but he had a sensitivity about him
that she found intriguing. She hadn't set out, when she came to
college to find a boyfriend, in fact she had deliberately avoided
the matter for a number of years. But Mark was different
somehow. No matter how thorny she tried to be, he would just
laugh it off and carry on caring for her. It was a strange situation
to be in for sure. Dare she love again? That was the question
she asked herself again and again. What would happen if it
failed like it had last time? Could she trust herself not to make
the same mistakes again?
These were all questions that she didn't know the answer to. Did
she even want to find out the answers in the first place? One
thing for certain she did feel alone. "Hi-Fi track 16 personal
collection". Anne sat back and listened to the music. It always
helped her think.
"I gotta take a little time
A little time to think things over
I better read between the lines
In case I need it when I'm older
Now this mountain I must climb
Feels like the world upon my shoulders
Through the clouds I see love shine
It keeps me warm as life grows colder
In my life
There's been heartache and pain
I don't know
If I can face it again
Can't stop now
I've traveled so far, to change this lonely life"
A loud knocking at the door interrupted her thoughts. "Music,
volume down 95%." She called and answered the door. She broke
into a smile as she saw Mark standing there.
"Did you forget?" he asked.
"Nope I wanted you to come get me," Anne said with a grin.
"Nothing new there then. Everything packed and ready to go?"
Mark asked. By now he knew it would be but he felt as though it
was his duty to ask.
"We'll have to hire boards when we get there," Anne
commented. She had been keen to get to the Florida keys for a
while and now she had the chance she leapt at it. The fact that
Mark was coming was a bonus. She hoped to get some diving in
too. This long weekend of theirs had been planned for a week
or so now and she just hoped that she was right about Mark.
Maybe it was time to open herself up to him?
"Did you get the exam results?" She asked expectantly.
"Sure did, I aced it!" Mark said and punched the air in triumph.
"Knew you would," Anne smiled back and gave him a
congratulatory hug.
"If you hadn't have fixed my car..." Mark said
"If is such a big word," Anne commented.
-- o -- o -- o --
"You and Alex seem pretty serious. I can't keep you away from
him can I?" Angela teased.
Elizabeth gave Angela a smile, "I have no idea what you're
talking about."
"Yes you do 'little miss, my boyfriend bought a house in
Cambridge, just so he could be near to her'," Angela teased.
"That was so sweet wasn't it! It's strange how the more I get to
know him as Alex rather than 'pain in the ass' the more I realize
I was wrong about him. We just connect!"
"I still haven't forgiven you for getting in before me. He is soo
cute," It had been a running joke that Angela was waiting in the
wings should Alex and Elizabeth split up. The first time it
happened, Deianeria had intruded telling Elizabeth to be careful,
but Elizabeth just ignored it. Still, she was pleased to know that
Deianeria still had her best interests at heart.
"No chance. Every time we meet, it's like we're bonding
together. I never thought I'd say it but our lives are intertwining,
becoming one. I can't imagine a future without Alex in it,"
Elizabeth swooned.
"Do I hear wedding bells?" Angela asked.
"IF and this is a big if he asked me I'd say yes. Oh Angela, do
you really think he would?" Elizabeth asked.
Angela gave Elizabeth a hug "Don't ask me. If he's any sense
he will. It IS romantic isn't it? Marrying your childhood
sweetheart."
"He was hardly my sweetheart," Elizabeth paused for a few
moments, "Angela Holden," Elizabeth said formally.
"Elizabeth Stephens," Angela replied.
"In the event of Alex and I getting married I want you to be my
bridesmaid," Elizabeth gave Angela a huge grin.
Angela gave Elizabeth another hug, "I'd love to," she said
tearfully.
-- o -- o -- o --
Mark and Anne had been an item for nearly four months, and
Anne had to admit the time had simply flown past. She had
enjoyed helping Mark on his course and his grades had
improved noticeably. A few weeks ago, he had taken her to
meet his parents, something that she was feeling a little nervous
about. Not because she thought she would make a bad
impression, but of what emotions it would stir in her. Much to her
surprise it had gone very well. Mark's dad had loved her car,
and his mom being captivated by her intelligence and
conversation.
Anne was now having a lay down on her sofa, and was reading
the news on her PDA. Earlier on, she had moved some money
around to her various accounts, so that she could to maximize
profits from an up turn in the futures market. On a whim, she
turned to the celebrity section of her personalized news-mail.
One article in particular caught her attention right away.
"Mr and Mrs Stephens are delighted to announce the
engagement of their daughter, Elizabeth to Mr Alex Richards,
son of Cathline Richards(Rachel Martin).
Mr and Mrs Stephens of Fury fame had been staying at their
island mansion in the Maldives when the news broke. Elizabeth
is currently in the middle of a medical degree at Cambridge
University, England and it is understood that the wedding will be
after she has completed the course. "
Anne gave a broad grin, "You go for it girl!"
Her PDA interrupted her reading "Anne, it's time to go. You are
due to meet Mark at the Theatre in half an hour."
"PDA, thanks." Anne commented. She had been looking forward
to this for days. Although it was only a local production, it had
been highly rated in the local newspapers, and besides, in these
days of interactive on demand TV it was a refreshing change to
watch something live.
Anne checked her watch; she still had a little time to work on the
final details of her paper. It should be ready in a month or so,
and she had now manufactured enough plankton to show the
principle to any that would doubt her. She still hadn't shared her
idea with Mark. It was better he didn't know; the ecologists
would have a fit if they found out. They would do sooner or later
of course, but by then the facts would be out. She had speeded
things up, as Mark's research and others from around the world
showed the rate of environmental decline was not gradually
declining. The recovery was normally helped by compensation
mechanisms within the ecosystems, but was now snowballing
out of control. These compensation mechanisms, such as the
increased growth of algae that would then decrease the amount
of CO2 were now past breaking point. Gaia had given it her best
shot, but under increasing population and industrial pressures it
was a one way battle. By hers and Mark's best estimates they
had less than sixty years before the ecosystem of the ocean's
collapsed. In ecological terms that was no time. If they didn't act
in the next two years or so it would be too late. Thanks to the
ark project the DNA of many species had been preserved after
their extinction. So some of the bio-diversity could be regained
in time but what good would it be if they had no habitable
environment to live in? Mankind would of course adapt. Already
they had the technology to compensate for the lack of Oxygen
in the atmosphere, but building these O2 re-circulation plants on
a global scale could take decades. That wouldn't prevent the
extinction of thousands of species in the meantime. She had to
succeed! The alternative was for mankind to live in domed cities
with regulated air, not being able to go outside for fear of sun
burn, and a landscape almost devoid of vegetation. Two
hundred years from now the Earth would be a wasteland.
Her thoughts were interrupted by a knock at the door. Was it
that time already? She opened the door, and gave a smile, "Hi
Mark. Ready to go?"
"Sure," Anne said, and closed the door behind her.
Half an hour later Anne had parked the car "We'd better get a
move on. It starts in 5 minutes," Mark said.
"Yep. We'll cut thru there," Anne said pointing towards a small
side alley.
"Ok," Mark said, and hand in hand they sped off.
On reflection this was not a good idea, Mark decided. The back
alley was dimly lit and the walls were sprayed with various
graffiti tags. Several large trash cans had been tipped over
leaving paper, food and everything else sprawling all over the
road. "We'd better hurry," Mark hissed, and they started to run
faster.
Suddenly two figures loomed in front of them barring their way.
In the dim street lights Mark could just make out an some kind of
emblem of their black leather jackets. In unison Mark and Anne
turned to leave back the way they had come, but another figure
was blocking their path. Mark had a sinking feeling in the pit of
his stomach. "Hi guys what's going on?"
The lead figure stepped forward, his face masked by a red silk
scarf. Mark's fear rose as he noticed a large looking hand gun in
the man's hand. He glanced across at Anne, who much to his
surprise wasn't looking scared at all. She was glancing around
as if calculating options. Mark moved across to put his body in
front of hers. He had to protect her at all costs!
The lead figure looked firstly at Mark, and then at Anne "Ok
here's how it goes. You give us your money, and the keys to
that nice Porsche you were driving, and we'll let you go."
"Not my car," Anne complained and moved to face the gang
leader. A move that put her in the firing line instead of Mark.
The gang leader leered at Anne. "I've just added something
else. Let me have a go with your girl as well!"
Mark moved forward to try and pull Anne out of the way, but one
of the other gang members pulled another handgun and pointed
it at his head.
Anne tried to placate an already tense situation, "Hey look, I
don't want any trouble. Mark give him what money you have I'll
go with him."
Mark couldn't believe what Anne was saying. She had refused
to sleep with him, saying she had wanted to wait, and now she
was going to go with some scum instead. "Over my dead body!"
"Mark, Please I know what I'm doing!" Anne hissed. There was
something in her voice that made Mark sure she had something
in mind.
"You heard your girlfriend," the gang leader leered.
Grudgingly Mark reached into his jacket pocket and pulled out
his wallet. He threw it to the ground. Still being covered by
handguns the gang leader picked it up, and said, "Thanks. Have
a nice day."
The gang leader then moved in and gave Anne a large kiss. He
held her head firm as he pressed his lips against hers. She
managed to break free and said "Not here. There!" She pointed
to a side alley a little way to the left.
"Anne!" Mark called and tried to stop the gang leader. He felt a
large thud on the back of the head and fell to the floor dazed.
"Next time it'll be a bullet," one of the gang members snarled.
The gang leader led Anne at gunpoint to the side alley. When
he was sure he was out of sight he pointed his gun at her and
demanded "Strip! Bitch"
Anne's tone of voice changed to a deathly whisper "My name is
Anne Baxter and I am the last living thing you are ever, ever
going to see!"
The gang leader gave a loud laugh "Yeah right,"
Anne raised her left arm and said "Watch"
The gang leader was amused at this young woman's bravado.
She was no match for him both physically, and he had a gun.
What could she possibly do to him? There was something in her
tone of voice that worried him. It was as though death had
spoken thru the voice of this young woman. His worry turned to
fear as he saw the flesh on the woman's started to shift. In a
matter of seconds her fingers had fused together to form a
sharp serrated bony blade. The bone traveled down until it
reached her elbow. Now her whole upper arm was a nasty
looking serrated blade. The gang leader gave a smile, no matter
what this woman was she was no match for a magnum.
Mark screamed as two shots rang out "ANNE!"
Seconds later a blood curdling scream came out of the back
alley.
Inside the Alley Anne concentrated and the bullet wounds
healed up with in a few moments. She pulled her blade arm
from out of the sternum of the gang leader. She concentrated on
her arm and the flesh reformed back into her hand once more.
Now it was time to deal with the other two punks. She now knew
that it was too late for Anne Baxter. As soon as she walked out
this Alley, then Mark would start asking questions. Although
there were no signs of the bullets on her body they had left two
rather large holes in her blouse, and the small amount of blood
that had seeped out before the wounds had sealed, had left tell
tale stains. She had a decision to make and quickly. Mark's life
was still in danger. If she disappeared now, then it would be a
number of years before she could resume work on saving the
oceans. She didn't have a number of years left before it was too
late so really there was no choice at all. She hoped Mark would
understand. For a fraction of a second she considered killing
him as well. There was the perfect alibi, but in spite of
everything she'd done before she couldn't bring herself to kill an
innocent man, especially one she had grown close to over a
number of months. 'It had to happen one day' she thought, and
walked out of the side alley.
Mark was still hurling obscenities at the rest of the gang when
Anne walked out. Mark caught a glimpse of her walking calmly
out and called out "ANNE! You ok?"
The gang member behind Mark shouted at Anne "Where is he
Bitch!"
In an icy cold tone that chilled Mark to the bone Anne replied, "I
killed him and you two are next."
"Wanna bet?" The gang member said and fired two shots at
Anne.
"Anne!" Mark screamed as he saw her stagger backwards as
the bullets struck her."
To Mark's amazement Anne kept coming. She was now moving
faster than his eye could detect. He heard a gargled, stunted
scream and the gang member guarding him collapsed in a
heap, his head nearly decapitated from his body, and blood was
pouring from an open neck wound.
The other gang member turned to flee but to he found his way
blocked by someone who looked like Anne. Both of the
creatures arms had been turned into serrated blades, and it's
head although resembling Anne was coated in bony armor.
"What, What are you?" the remaining gang member stammered.
The figure said in a voice straight from death it's self. "My Name
is Dr Elizabeth Anne Bexley and I am the last living thing you
are ever, ever going to see."
Before the gang member could react the creature that had been
Anne rammed both her bladed arms into his chest and ripped
them outwards, nearly tearing him into two.
This was too much to Mark, still dazed from the blow to the head
he collapsed to the floor in a faint.
-- o -- o -- o --
"Hey Angela you in there? The lights don't seem to work"
Elizabeth called into her darkened apartment.
Elizabeth walked inside. There was a green light LED showing
from the TV, so that meant there was still power in the room.
Light's didn't just fail There was something wrong!
A tingle of fear trickled down her spine as she walked into the
living room. There was nobody there. She waited for a few
moments to allow her eyes to get accustomed to the dark before
venturing into the kitchen. She stumbled as she walked into the
Kitchen and managed to keep to her feet. She turned around to
see what it was and gave a loud scream as she saw Angela's
body lying on the ground.
Instinctively she felt for a pulse and breathed a sigh of relief.
The pulse was strong, but Angela had obviously been sedated.
Her PDA was still in the living room table and the police were
only minutes away. She walked back into the living room and
tried to see it in the darkness, "PDA ALARM!" she called loudly,
and desperately waited for the beep of confirmation, but none
was forthcoming. Suddenly she was grabbed from behind and
felt a damp, sweet smelling cloth go over her mouth. Seconds
later it all went black.
-- o -- o -- o --
Mark awoke an indeterminate time later. He felt a cold, wet cloth
soothe the bruise on his head. He opened his eyes to see Anne's
face looking down at him. Her blue eyes looked at him with
concern. "You should be ok. There's no concussion."
"Where am I?" Mark asked woozily.
"Your place," Anne said softly.
"You, You," Mark started to say. The visions of Anne or
whomever she was cutting down the gang in front of him filled
his mind. To think he had loved her!
"They shouldn't have tried to take my car," Anne said, with a
smile.
Mark managed to sit up. How could she make light of killing
three people in such a brutal manner?
"Here take this," Anne said, and gave Mark a strong, sweet cup
of tea. She moved over to the far side of the room, swung an
armchair around, and sat in front of him.
"Thanks," Mark managed to say. All he could think of was the
sight of the near headless body of the gang leader collapsing in
front of him.
"I expect you have a million questions. Let me start. Who am I?
How did I do what I did? And what's going to happen to us?"
Mark managed to nod "Those will do for a start," He took a swig
of tea and felt a little better.
Anne gave a deep breath. This was going to be hard as it was,
"The name I was born with is Elizabeth Anne Bexley. I was born
in 1969 to Margaret and Dr William Bexley. I obtained a medical
degree at Harvard in 1994 and worked for a time in my father's
hospital."
"No you can't be, you're dead!" Mark stammered. His heart felt
as though it had been ripped apart. Anne his dream woman had
turned out to be a monster! But what would she do if he dumped
her? His dismay turned to terror.
"I told you I was more trouble than you could handle," Anne
commented.
"The world saw your body," Mark tried refute the story of the
woman in front of her. Anne had to be teasing, the alternative
was too horrific to contemplate.
"The world saw a body, not mine," Anne said softly. She had
noted the look of terror on Mark's face. She knew this would
happen.
"Tell me about it, all of it. How you felt, why you did what you
did. Please, I need to know," Mark averted his gaze as he said
it.
"What's to tell? You know the truth. Cathline wrote it all down,"
Anne commented.
Still not looking at her Mark asked "I read it years ago, anyway,
She didn't write down what you felt, how you feel now. Am I in
danger?"
Anne gave Mark a look of concern "Why should you be?"
"Because If I dumped you you'd do to me what you did to
Matthew Stephens."
"Do you know how long ago that was? Nearly twenty five years
ago. You want to hear things from my point of view, fine. I hope
you have all night."
Mark turned to face Anne "Elizabeth, Sorry Anne. I loved you.
Maybe I still love you. I dunno how I feel at the moment. If I am
to trust you I have to know first hand.
"Ok. Here goes. You ever been hurt so badly you felt as though
you wanted to die? Felt betrayed and embarrassed so much
that the only way clear was to end your life?"
"Not until tonight," Mark said softly.
"Well that was how I felt. I nearly killed myself after Matthew left
me, but my mom caught me just in time. They knew that I
needed a change of scene to help me get my mind away from it
all. The last straw came when I tried to save a small girl, but
failed. Mark, I ought to have saved her but I felt too distracted to
concentrate. She died because I was hurt. She was the first of
the people I killed," A tear formed in Anne's eye. It had been
years ago but the pain was still there.
"You can't blame yourself for that! She could have died
anyway!" Mark tried to sound comforting.
"I thought that at first, told myself that when I woke up in the
night crying for that little girl. I had to tell her parents Mark, I'd
done it before; it goes with the job but this was different. If only I
didn't feel like I did I would have seen the embolism that killed
her."
"Did anyone else spot it?" Mark asked.
Anne shook her head "No. But my instinct told me it was there."
"I think you were punishing yourself because you thought it was
your fault Matthew left you." Mark commented.
"Maybe. Anyway, I was fine until I saw Matthew with Kat after
they had been to the cinema. It was strange; it was as though I
had been taken over by a different person. My normal morals
went out of the window until all that remained was the person
who called herself 'Lizzy'."
"You mean you were possessed? That's a bit from the dark
ages isn't it?" Mark commented.
"No not possessed. As you may remember I had a flaw in my
brain. It made me susceptible to MPD. Lizzy talked me into
letting her get her own back on Matthew. Eventually as time
wore on there was no more Elizabeth, only 'Lizzy'. Sure, I was at
the back of her mind screaming to get out, but it was like being
in a sound proof cell. The thing was, Lizzy was so much cleverer
than I was, she was able to work things out, plan things and do
things I never even dreamed of."
"So this 'Lizzy' became your dominant personality?"
Anne nodded "I was consumed by hatred. Nothing mattered to
me except exacting my vengeance on Matthew and Kat. People
were just tools to use and toss away. What did one life matter?
What did a million? Any price was worth it to get back at
Matthew," Anne stopped to wipe away the tears forming in her
eyes.
"Is 'Lizzy' still around?" Mark asked worriedly.
Anne shrugged "Who knows? But I doubt it. As soon as I
realized what the problem was I took measures to cure myself. It
took me a few years to work it out but using my changeling
organ I cured the flaw in my brain. I'm cured, permanently."
"Sorry, carry on with the story," Mark commented. As horrified
as he was, the whole thing fascinated him.
"Anyway you know what happened after that. I had Jane
kidnapped, Cathline too, and took Jane's place in time to see
Matthew just changing into me."
"What did it fell like?" Mark asked. By now he was intrigued.
Anne replied I wrote down what it felt like in my journals
'You can't brush me under the carpet, you can't hide me
under the stairs. The custodian of your private fears, your
leading actor of yesteryear, who as you crawled out of
the alleys of obscurity, sentenced to rejection in the
morass of anonymity.
'You who I directed with a lovers will, you who I let
hypnotize the lens. You who I let bathe in the spotlight's
glare. You who wiped me from your memory like a
greasepaint mask, just like a greasepaint mask.
'But now I'm your snake in the grass, the ghost of film
reels past.
I'm the producer of your nightmare and the performance
has just begun, it's just begun..."
I felt elated. All the work I had put in over the past few years had
come to fruition. It was nothing like I have experienced before or
since. I saw Matthew's legs had become my legs. Their long,
slender shape was just visible under his pajamas. I knew from
tape records how he'd screamed in horror as his legs had
changed one after the other, and then pain he felt when the
withdrawal symptoms of the drug I had invented took effect.
I walked in and saw his body start to reshape. His normal
muscular hairy chest flattened out, and the hairs retracted back
into his body. There was a crunch of bone as his rib cage
rearranged it's self and his stomach almost caved in to form a
copy of my female one. He looked odd laying there, a collection
of male and female. His round shoulders and collarbone looking
as though all he needed was a pair of tits. Of course he had
much further to go but it was then I knew I had done the right
thing."
Anne's matter of fact tone chilled Mark to the core "You sound
as though you are proud of what you did."
Anne noticed Mark's fearful look. "I was. Still am really. Re-
writing the laws of nature was some feat. It wasn't me who did it
of course. 'Lizzy' was able to do it in months, where I would
have taken years. I am proud of what I achieved, not the results
or the motive. I caused years of misery and I'm not proud of that
at all. How much more do you want to know?"
"All of it," Mark said softly.
In a way Anne was relieved. Speaking about what she had done
in the past helped exorcise some of the ghosts she carried
around with her. In telling Mark, someone who'd she'd only just
got to know she found it releasing. As if burdens she had carried
around for years could now be shared. But did Mark still want
her? More to the point did she still want Mark?
Anne continued, "I learned he had taken two more pills. I don't
know if you remember, but that was how the drug was being
administered. Anyway, It wasn't until a few hours later I heard a
scream and came running into the bathroom. His hips were
reforming in front of me. They became smaller and much
rounder. He bent double as his womb started to form inside of
him, and he turned around to look at his ass rapidly becoming
more and more feminine. I had such a cute ass too. He stood
up and surveyed his new body. He now had my curves and
looked every bit the woman he was becoming. He took
particular note of the way his public bulge merged into his flat
stomach. All the time I was feeling elation that it was working, I
felt no pity and no remorse for him. 'Lizzy' was utterly ruthless in
that regard."
Mark drank the rest of his cooling tea. Hearing Anne talk like
this, so matter of fact and so dispassionate only served to make
him more wary of her.
"I know what you're thinking. How can I talk so coldly about
ruining a man's life? The answer is that it was all a long time
ago, sure I feel sorry for what I did, but I put it right again. Mark,
that's the important thing I put it all right again."
"What happened next?" Mark asked
"You're determined to drag everything up again aren't you. I've
had over twenty years to deal with this." Anne commented
"And I've had twenty minutes," Mark replied.
"Listen I don't owe you anything! I could have just vanished
without a trace back there. I made a choice to reveal myself to
you. I hoped you'd understand, maybe I was wrong," Anne said
softly.
Mark shrugged his shoulders in desperation "I'm trying to
understand, but to do that I need to know everything. No
secrets, no masks and nothing left out. You need to do this as
much as I need to hear it!"
Anne had to admit Mark had a point. She was finding this
releasing "Anyway on with the story. His arms changed from
muscular manly ones to my delicate and slender ones. We had
an argument on what to do next, and I walked out him leaving
him to suffer on his own for a while. When I returned a day or so
later he now wore my face and had grown a pair of tits. He was
now a woman save one place, his dick. I persuaded him to fuck
me knowing full well that by the morning his cock would become
a vagina. I wanted the pleasure of making him fully female
myself. You know the rest of the story after that."
"How did it feel killing all those people, ruining all those lives?"
Mark asked.
"It felt good. Every time I killed or maimed someone 'Lizzy'
became pleased. The knowledge that Matthew and Kat's
marriage was wrecked, and that Cathline was now alone gave
her great delight. I was all set to live out my life as Rachel Martin
when my parents were killed in a car crash. If Matthew jilting me
was the trigger than this was the cannon shell. My anger at him
grew daily, I saw it as his fault they had died. I was determined
to see him hunted down and killed. My fury grew in intensity until
it consumed me totally. 'Lizzy' swamped my mind. She was
Elizabeth Bexley, the old me, the compassionate me had long
been disposed of and only 'Lizzy' remained. It wasn't until my
final battle with Kat that my fury began to fade"
"When you were a mermaid right?" Mark asked.
"Yeah. That's why I love the ocean so much. The time I spent in
exile there calmed me. I saw things you wouldn't believe. Shoals
of silver side fish turning as though one large super-organism
forming flashes of silver lightning underwater, twisting and
turning forming impossible colors. I saw where sharks go to die,
ship wrecks that were monuments to man's folly. I now longer
saw it as exile; it was a blessing. It remained that way until the
Guild caught me. When I was in captivity I was able to rid myself
of 'Lizzy', and finally get the real me back. It took me months of
soul searching and thanks to medical treatment she was gone
forever."
"I read about that in Cathline Richard's book."
"Most people have," Anne commented. They were now coming
onto the most painful part of all.
"Did you use your changeling organ to kill those gang
members," Mark asked fearfully.
Anne nodded, "What happened after the Fury directive will
come later, but yes it was. It enabled me to shrug off the bullets,
move faster than most people can see, and shape my hands
into razor sharp weapons."
Mark remained silent. He had never seen anything like it. Anne,
his beloved Anne, had ruthlessly killed with extreme prejudice
those who had sought to harm them. The gang members never
stood a chance. His mind flicked back to the image of the final
gang member nearly being torn in two.
Anne continued. "You have no idea what it felt like when Tel-
Aviv and then Cairo were destroyed. I had felt elated again that I
had saved Tina Cox's life, but the death of fourteen million
people wiped that out right away. That was the hardest time of
all. I still have nightmares about what my mistake cost. They
haunt me Mark even after twenty years, and nothing I can do
can wipe away the screams."
"What happened after that, after you defeated the Guild," Mark
said trying to ignore the fact that Anne was now crying softly. He
needed to press on. To find the answers both he and she
needed.
"I met with the vice president, actually he was the president in
all but in oath. I needed to be sure my future was safe. As I
remember it the conversation went something like this.
I asked him "When this is over I want three things."
The Vice President replied. "Which are?"
As casually as I could muster I said, "I want a full pardon.
I can't live my life as a fugitive, hated and despised by all.
I want all charges against me dropped."
The Vice President had expected something like that,
"Now wait a minute. You haven't just knocked over a
drug store and ran away with a few cigarettes. You're
responsible for the murder of eighteen people,
kidnapping, and crimes against humanity. I can't just
wash over all that and let you go."
"Fine, you sort this mess out," I stood up and turned to
go. I knew the vice president had no choice but to agree
to my terms.
He thought for a few moments and then had an idea, "Ok
I'll pardon you on one condition."
"Which is?" I asked
"You're intelligent, work it out. After you've done that, tell
me your decision," The Vice President said."
"So what was his condition?" Mark asked.
"That I spent a period of time working for the government. My
changeling abilities were far too useful to just let run loose. It
also enabled them to check if I was really cured. Using a sample
produced from my DNA Machine before they blew it sky high
they turned a secret service guy into a copy of Rachel Martin.
He committed suicide in my place. It was that body that Matthew
and Kat saw, and that body that was buried next to my parents
in New York. I stood and watched them do it. I wrote the note
and left all my belongings behind for them to clear up."
"I thought an autopsy proved it was you," Mark said.
"It proved that the body had a unique make up, not that it was
me. Matthew, Kat and Cathline believed it was me at the
hospital. They even signed the identification forms and
everything to say so. Therefore to all the world I was dead."
"So A guy died so you could go free?" Mark asked.
Anne nodded, "He was keen to do it, or so I was told. Wanted
to give his all for his country. His family can be assured his,
sacrifice saved a lot of lives. Anyway, I worked for the CIA for
fifteen years as their number one courier. My ability to infiltrate
into anywhere, and escape unseen was critical to the success of
a number of government operations. I smuggled plans for a new
Chinese missile out from Beijing, underwent scouting missions
for counter terrorist strikes, helped smuggle that Russian doctor
out from the new USSR, and everything in between. They even
gave me a codename, 'Friday'."
"Friday?" Mark queried
"It came from a Robert Heinlein book about a genetically
engineered woman who was the government's number one
courier. Anyway I was 'Friday' for fifteen years. After my time
was up they gave me some money, well a lot really, and a new
identity. I used my changeling organ to turn myself into
Elizabeth Anne Baxter, and start a new life here."
Mark had a revelation, "So that's how you survived the boat
wreck!"
Anne nodded, "Yep. A forty mile swim is no distance at all for a
mermaid, neither are sharks or currents. I dove deep to avoid
detection, and landed just where I would have if I had really
used the currents. It was a stupid thing to do. I should've just
waited around for help."
"And it was all going fine until tonight!" Mark said bitterly. How
had he fallen for this inhuman monster? Remorse or not she
was still a killer at heart.
Anne nodded "I know. Mark I had no choice but to kill them,"
She had detected Mark's face drop once more, and knew what
he was thinking.
"Didn't you? You could have stunned them. Still mercy isn't your
style is it?" Mark said bitterly.
Anne's voice became angry "Hey time out!! I don't just kill
people on a whim. If there was any other way I would've taken
it; but there wasn't! Look! I've just told you stuff that nobody
knows but you and me. Ok, if I'd have stunned them they'd have
told the cops that they'd shot me four times, and that I still kept
coming at them, and my cover would be blown. If I had faked
death they would have killed you. Maybe I did overreact, but
when people I love are in danger I do whatever I need to protect
them."
Mark was staggered "Love?" Anne had just admitted she loved
him.
"Yes love. Why the fuck do you think we're still going out after
four months, when my every instinct was to run away? It wasn't
your cooking that's for certain. You make me feel me again. I
haven't felt the real me for nearly thirty years!" Anne snarled.
Yesterday Mark would have felt elated, as though he had just
won the state lottery, but now he just felt numb. The woman he
loved was in fact Dr Elizabeth Bexley!" I need some time to
think."
"I thought you loved me?" Anne said softly
My God, what have I said? Mark thought, "I can't end it with you
can I? You'll come after me, like you did Matthew."
Anne stood up "After all I told you, you still think that? Then
there's nothing more we can say to each other. I thought you
loved and trusted me, guess I was wrong. Goodbye Mark."
Anne walked out leaving a tearful Mark behind.
-- o -- o -- o --
Still sobbing Anne ran to her car and drove to her dorm. She
could partly understand Mark's dilemma but if he truly loved her
he would put that to one side wouldn't he? She opened her door
and ran inside. She was so upset she could hardly walk and she
collapsed onto the bed. "Hi-Fi track 20 personal collection"
She buried her head into her pillow and cried like she hadn't for
nearly thirty years. Once again her one chance of happiness
had been dashed because of who she was.
"The world was on fire
No one could save me but you.
Strange what desire will make foolish people do
I never dreamed that I'd meet somebody like you
And I never dreamed that I'd lose somebody like you
No, I don't want to fall in love
[This love is only gonna break your heart]
No, I don't want to fall in love
[This love is only gonna break your heart]
With you
With you
What a wicked game you play
To make me feel this way
What a wicked thing to do
To let me dream of you
What a wicked thing to say
You never felt this way
What a wicked thing to do
To make me dream of you
And I don't wanna fall in love
[This love is only gonna break your heart]
And I don't want to fall in love
[This love is only gonna break your heart]
World was on fire
No one could save me but you
Strange what desire will make foolish people do
I never dreamed that I'd love somebody like you
I never dreamed that I'd lose somebody like you
No I don't wanna fall in love
[This love is only gonna break your heart ]
No I don't wanna fall in love
[This love is only gonna break your heart]
With you
With you
Nobody loves no one."
-- o -- o -- o --
The phone ringing beside Matthew woke him up. "What the
hell!" he muttered. The bedside clock said 4am. He let it ring for
a few more moments, hoping whoever it was would hang up, but
to his annoyance they didn't. Groggily he picked it up "Hello"
"Is that Mr Matthew Stephens?" The voice had an English ring
to it, but Matthew couldn't place the accent.
"Yeah," Matthew muttered.
"My name is inspector Alan Jones of the Cambrideshire
constabulary. I have some bad news for you, I'm afraid. It's
about your daughter, Elizabeth." Matthew's blood ran cold. The
fear that haunts every parent rippled thru him in an unstoppable
tide.
"What is it? Is she ok?" Matthew managed to say.
"I'm afraid she's been abducted. She didn't turn up for her
lectures this morning, and her fiancée found her apartment had
been ransacked and she was missing."
Still in a dazed state, it took Matthew a few moments to take it in,
"Do we know anything else? If' it's about money?"
"We don't think it's about money. They would have left a
demand or instructions if it were." Alan said softly.
"So how do we play this?" Matthew asked, now starting to get
his mind in gear.
"We wait for them to contact you. I would suggest one of you
waits there, and the other flies over to be with us. That way we
get all the bases covered. Alex Richards is here helping us."
"But we're nearly a whole day away. Anything can happen in
that time. Can I speak to Alex?" Matthew complained.
"Give me a few moments," Alan said.
A few seconds later heard Alex's voice. It sounded tired, worried
and fearful, "Hi Matthew," was all he could bring himself to say.
"Alex are you ok? You sound awful," Matthew commented.
"I'm sorry Matthew. I tried to look after her for you. If only I had
been there. Why'd they take her Matthew she hadn't done
anyone any harm?"
"Did her room mate see anything?" Matthew asked. He hoped to
divert Alex's self pity into something more constructive.
"Angela? She's gone too. Matthew I'm so sorry,"
Matthew could hear that Alex was trying to fight back the tears.
"It's ok. Nobody blames you."
"Thanks but when she's safe then I'll be happier. Inspector
Jones wants to speak to you. I'll hand over to him in a sec. Tell
mom for us will you? I hate being alone out here."
"I will," Matthew promised.
"Hello Mr. Stephens. We do have one lead, which we are
investigating at the moment. We have contacted the FBI and
interpol with this lead. I promise you we will do our utmost on
this
Kat gave a yawn and opened her eyes. She saw Matthew's
worried face and saw the phone against his ear "What's up?"
Matthew indicated Kat to be quiet and then answered "What's
the lead?"
"I'd rather not say at the moment, but it looks a good one. Look,
the best thing you both can do is remain calm. Over eighty
percent of abductions turn out just fine. Trust us, we know what
we're doing. My number is in your phone's memory. Call us if
anything happens at all."
Still in shock Matthew replied, "Thanks Inspector we'll be in
touch," Matthew put the phone down gently.
"What is it?" Kat demanded.
Matthew took a deep breath, hardly believing it himself
"Elizabeth's been abducted. It happened last night they think!"
Kat gasped "No. Please God!"
"Whoever did it left no note, no ransom demands or anything.
She's just gone!"
"Poor Alex he must be beside himself. I'll go," Kat said.
"I'll tell Cathline," Matthew said.
-- o -- o -- o --
Anne woke up at midday. In the stark light of day her situation
hadn't gotten any better. She didn't blame Mark for the way he
felt. It was understandable in a way. Not only had she deceived
him, she had scared the crap out him with her summary
execution of the gang. Didn't he understand that she would do
anything to preserve the lives of those she loved and cared for?
That taking the gang down because they threatened them both
was an instinctive reaction from her? In fifteen years of working
for the CIA she had been trained to act on instinct. If you didn't
you were dead, and so were those you were trying to protect.
She suspected it wasn't only what she'd done to the gang that
bothered Mark; it was who she really was. Sure, it had been
twenty years, but some things refuse to die even after that
amount of time. Now she was trapped. To run away and hide
would mean that time would run out for her idea and therefore
the oceans. To stay would mean facing up to Mark and the
consequences of telling him the truth.
Maybe that wasn't such a bad idea? She had spent the last
thirty years running away from herself. Firstly, in her own mind,
and then as Anne Baxter. But was Mark the one to run towards
rather than away from?
The phone ringing interrupted her train of thought. Hoping it was
Mark she dashed to it "Hi."
A cold voice with an indeterminate accent answered "Friday,
This is Heinlein"
"Fuck off! I don't work for you any more. I did my time and now
it's my life," Anne snarled down the phone.
"It's about your daughter," the voice replied.
"What about her? I left her with Matthew and Kat. Vowed never
to go see her because of what it would do to their family. Look,
Go away! Whatever it is, find someone else!" Anne snapped
"The FBI have informed us that she has been abducted in
England," Heinlein informed her.
Anne's anger turned to worry. She had spent years of
wondering what Elizabeth had been up to, wanting so much to
see her first steps, hear her first words, but not daring to go near
in case it ruined things for her. Now, deep inside her the feelings
that only a mother can know were bubbling up. Why had she
decided to stay away? Why did she always inflict guilt on herself
for her past? Whatever had happened then, she now had the
chance to put right here and now. When Elizabeth needed her
most she would not desert her in her hour of greatest need
"Friday are you there?"
"Yes. Ok, Consider me available. But Surely the FBI and Brits
can deal with it?" Anne asked.
"The kidnapping yes, but not this part. When it was clear exactly
who your daughter was, we made an agreement with her
adoptive parents."
"Which was?" Anne asked.
"That should she show the same symptoms as you did, then
she would be tested, and if she failed incarcerated in an
institution for her own safety and of those around her," Heinlein
replied in an emotionless tone.
"Sounds reasonable. If I'd had treatment earlier, a lot of lives
would have been saved. I fail to see how that is relevant
though," Anne commented.
Elizabeth was seen being loaded onto a plane at Stanstead
Airport in England. A hostess saw the top of her head as she
was being bundled out of a waiting car. It wasn't until news of
Elizabeth's abduction was on the news did she remember it, and
reported it to the Brits. They tracked the owner of the aircraft. It
is registered in the name of James Adams. It took off, and
landed at Charles De Gaule airport before we could alert the
French authorities."
"So far it still sounds like a job for the police. James Adams?"
Anne queried.
"The James Adams in question is the leader of the Children of
Bexley cult," Heinlein said. Again his tone was matter of fact.
"My god," Anne gasped. The penny had dropped.
"Our analysis indicates that they want Elizabeth to become the
new you. Once she has been indoctrinated they could release
her, she could make up any story she wished and they would be
off the hook. She could say that she went voluntarily and she
forgot to tell people where she was going and we would have
nothing to prove otherwise."
"The Bastards!" Anne swore.
"Indeed. The longer they hold her, the more chance they have
of not only indoctrinating her, but of invoking the same MPD that
afflicted you. We cannot allow that to happen, both for her sake
and for those who love her. James Adam's is in LA at the
moment. He is the only one who knows where Elizabeth is being
taken. The British police and our own have agreed to hand this
over to us. Why is not your concern, just that it's your job to go
and get her back before it's too late."
Anne shook her head in disbelief. Why would the police hand a
simple kidnap over to the CIA? "There's something you haven't
told me yet."
"Correct. Although we reached an agreement with Matthew and
Jane Stephens over Elizabeth's fate we put in place our own
safety protocols. Elizabeth is much too intelligent not to escape
from hospital either by outright escape or by making out she is
well once more. She is far too dangerous to fall into the hands
of another Guild! We cannot allow that to happen again! The
government policy on her is. Should she fail the test then she
would be killed."
"That's inhuman! How can you justify that! You Bastards!" Anne
swore. She knew what was coming next, but dare not believe it.
She wanted to hear it for herself.
"We can justify it because of the fourteen million who died last
time. We cannot and will not allow a psychopathic murderer to
develop DNA tech once more. You never did see the big picture
did you?"
"Fuck big picture! How do you even know she will! You're
accusing and executing her for something she might not even
do!" Anne was outraged. She hadn't signed up for this.
Heinlein ignored her protest "When you have recovered her, we
want you to test her, and if necessary carry out the elimination."
"NO fucking way you bastard cunt!" Anne swore. What she was
being asked to do was evil.
"Would you rather someone else test her? Some psychologist
who doesn't know exactly what she is going thru? Maybe even,
a psychologist fresh out of training who may make the wrong
decision? I had to pull a lot of strings to get you back on the
team. Friday, I'm offering her the only chance she has. That
chance is you. Off the record I think this sucks, but I do what I'm
told and so will you! Innocent lives may be at risk. If we can
save those lives then it has to be worth it. If you remember what
you were like you know that she will kill given half the chance."
Anne sighed. Heinlein was right. She was the best person
qualified to judge if Elizabeth was ok. If she refused then
somebody else would, and that somebody else would kill, if so
ordered. Heinlein had stepped out on a limb for both Anne and
Elizabeth, at least giving them a fighting chance. Heinlein was
also right in that an unstable Elizabeth would kill given the right
trigger. "Ok Heinlein you win. But just being off the drugs
wouldn't be enough to trigger her MPD. Something would need
to happen to her or someone she loved in order for that to
happen."
"That's what's worries us. We have all her immediate family
under constant watch. Her best friend Angela Holden is missing
as well. We think they may endanger her and use her as the
trigger," Heinlein sounded relieved that Anne was on board
once more.
"I dunno. That might not be enough. It depends on how close
Elizabeth was to her. All taking the drug away would achieve is
to allow the MPD to manifest itself. I had no qualms about
destroying Cathline's life and she was my best friend. Anyway
We're wasting time have the police grabbed the cult leader yet?"
"No and they are not going to. As soon as they touch him his
lawyers will be down on us like a shot. Only his plane was used,
and I'm sure he as a rock solid alibi. If Elizabeth is to be saved it
falls to us to deal with it."
Anne swore. The Bexley cult had it all worked out, and they had
her only child. She tried to quell the fury that was growing inside
her and channel it into a more constructive outlet. "Do I have full
authority to deal with it as I see fit?"
"Yes," Heinlein stated.
"Including lethal force?" Anne said calmly.
"Use of lethal force is approved," Heinlein confirmed.
"I hoped you'd say that," Anne commented. Her voice was the
same icy tone that had terrified the gang the night before. How
dare those bastards take her daughter?
Quelling her anger for the moment Anne stated "It'll take me
hours to get to LA. By that time it could be too late, and after
that fuck knows where Elizabeth is. France was it? That's at
least ten hours away. We're talking nineteen hours. That's more
than enough time for them to do what they are going to do to
her."
"Ok, in twenty minutes or so A chopper will pick you up from
Marshall's golf course a few miles from where you are, and take
you to an abandoned airfield a few miles away. You'd better be
quick, as the chopper will attract attention. From there we have
arranged a lift for you to where ever you need to go."
Anne thought. Whatever lift they had arranged had to be fast,
very fast, if they were to stand any hope of saving Elizabeth.
Suddenly it came to her "You have a starplane?"
"Wait and see. The chopper pilot will fill you in on the rest."
"Heinlein?" Anne said.
"What?"
"You're a bastard!"
"It's nice to know your opinion of me hasn't changed over the
years," Heinlein replied.
-- o -- o -- o --
The helicopter carrying Anne swooped low over a small forest.
In fact they were so low that Anne could see the individual
branches of the trees below. Her pilot hadn't said a word and
had only given her an address in Redondo Beach LA. Her new
body felt strange, it always did after a full body change, but
Anne had to safeguard the life she had made as Anne Baxter. It
wouldn't do for Anne Baxter to be caught doing what she
planned to do with the cult leader or his cronies. She was now a
blue eyed redhead about five feet eight with a slim, athletic
figure, and she was wearing a black spandex cat suit, which
would stretch as and when she used her changeling abilities.
She glanced down at her new legs and onto her arms. Soon
they would become blades, armor plate bone, and poison tipped
spines. She could become anything and everything in nature's
arsenal. A living biological weapon. She sat back and gave a
grim smile, "Watch out you mother fucker the hell bitch is back!"
she whispered as if to the cult leader.
She breathed out, trying to contain her anger. She hadn't been
this furious since her parents had died nearly thirty years ago.
She knew she was still on the back foot. She had just broken up
with Mark and now this! She had only the vague glimmerings of
a plan of her own devising, but at least it was something to work
from. Anne closed her eyes and tried to relax. She could feel
the fury brewing inside her again but this time she let it grow
inside. She remembered the way in which she had killed
Hassan all those years ago. She remembered the warm taste of
his blood, as she had used a secondary set of fanged jaws to rip
a hole thru his skull as she had kissed him. As she stood over
his body it had given her immense pleasure to see his brains
seep out all over the floor. This was far too quick a way to deal
with those who sought to harm her child. To those who would
rob her daughter of the life she so deserved with Alex, and to
those who would wipe away the joy that she had given Matthew
and Kat over the years. For a moment, she was afraid that Lizzy
would come back, that her fury would trigger her off again but
thankfully 'Lizzy' was nowhere to be found in her mind. This
moment was the acid test of her 'cure'. However part of her
wished she could turn over control to her and come back when it
was all over. It didn't work that way though. This was something
she needed to do. She regretted not taking down the Children of
Bexley cult a few months back. They had taken what she had
done and tried to dismiss it as a hoax, revered her as some kind
of holy figure, and now they had endangered her own flesh and
blood! They would pay a heavy price for their actions, she would
see to that!
She glanced across at the backpack she'd been given by the
chopper pilot. This was her 'goody bag', as she had called them
over the years. She was getting bored of the non-conversation
from the chopper pilot, so she picked it up and peered inside.
The contents hadn't changed much since she'd last been on a
mission, infra red binoculars, window paste and her most hated
object of all, a colt PI4543 silenced pistol. She knew this wasn't
for her protection, she could take care of herself; it was for killing
her own daughter. She picked it up and held in her hand. To
her surprise it was very light and it's balance was perfect. It
didn't seem to be made of metal, as it's surface was a cold matt
black and not shiny as metal would be. She decided it was
probably ceramic based, which accounted for it's lack of weight
She spent a few moments familiarizing herself with it, before
unclipping the small transmitter from the trigger mechanism and
pinning on her catsuit. From now on the gun would only fire if
she pulled the trigger. Ensuring the safety was on she slipped it
into her belt and prayed she would not have to use it.
The helicopter reached an old airfield. Its concrete runway was
broken up and uneven. Here and there old rusting aircraft lay in
state. Anne could see no sign of her 'lift'. She looked closer and
on the grass could see a slight shimmering effect. It was though
something was not quite there, as if it was half in and half out of
existence. She noticed an old Dodge UV parked to one side of
the runway. At the sight of the chopper, a man got out of the UV
and ran towards where the chopper was going to land
"What's that?" She asked the pilot, pointing at the shimmer.
The pilot just shrugged and after a few moments landed the
chopper.
Anne stepped out of the chopper, her hair was being buffeted by
the downdraft of the still rotating rotorblades. She looked around
and saw the man running towards her. The man, in an USAF
uniform put out his hand. Anne noticed the colonel insignia on
his collar "Hello Colonel."
"You must be Friday. I must remind you what you are about to
see if is beyond top secret. You will promptly forget everything
you have and will see."
"Don't worry I intend to. Now where's my lift?"
"This way," the colonel said indicating the direction of the
shimmering object. On the ground Anne still couldn't make out
it's shape, only that it was about seventy feet from one end of
the shimmer to the other.
Anne was again buffeted as the chopper took off.
A few seconds later they reached the object. Anne put her hand
on it and felt metal. "What is this thing?"
"This is the Aurora 3," the colonel stated.
"Why can't I see it properly?"
"It's a combination of Electro-molecular paint, advanced avionics
and optical form camouflage." The colonel was obviously proud
of his toy.
"In English please," Anne stated.
"It's paint scheme can change color and shape to suit it's
surroundings by changing the amount of current running thru it,
and the shape of the aircraft is designed to produce optical
illusions. In layman's terms it's color and shape confuses the
brain so much that the brain chooses either to ignore it, or that it
has no discernable shape at all. It's undetectable to radar and
infrared. This is as close as you get to being invisible."
Anne was impressed. "Cool! Is it fast? I need fast!"
"So I was informed. You've heard of the star plane right? The
passenger aircraft that flies to low orbit and then descends at
hypersonic speeds. New York to London in an hour, New York
to Australia in two?"
"Yep. Not in general service yet is it?" Anne said.
"Well Aurora here will go anywhere in the world in less than an
hour, including take off and landing,"
Anne smiled; this was just what she needed. "You know what
they say about men and the size of their planes don't you?"
The colonel smiled, took out a small key ring and pressed a
button. The shimmering effect cleared around the nose of the
object and Anne saw a cockpit section emerge. There were a
series of grab handles leading up to it.
The colonel gestured towards the cockpit "Ladies first."
-- o -- o -- o --
The colonel strapped Anne in tightly and made her put a figure
hugging suit and an enclosed flight helmet on. He told her the
suit would provide everything she needed oxygen, radio and
protection from the high G forces she would feel. Anne listened
intently, taking in every instruction. Unlike the Star plane this
aircraft gave no cosseting ride. This was meant for military use.
"Ready?" The colonel's voice crackled thru the intercom
Anne gave her straps a last tug, "Sure, Check."
Anne thought there would a noise, like a rocket or something
but all she detected was a slight surge of power and a small
vibration thru the cockpit. She had also expected to taxi along
the runway and take off normally, but slowly and almost silently
she felt herself lift of the ground and go straight up. Suddenly
the cockpit went opaque, but as she turned her head a small
portion of her visor showed the view outside.
The intercom crackled "We'll be using stealth engines until we
get to 20,000 ft. I've made the cockpit opaque to ensure the
camouflage is effective. I'll give a countdown before we use the
ramjet, and then finally the rocket engines. Enjoy, you'll be in LA
in thirty minutes."
Anne felt the nose point upwards and was immediately rammed
into the back of her seat. She could feel the G forces pushing
every muscle and bone in her body into her seat. She felt her
arms and legs go a little numb as the blood was pushed away
from her extremities and into her body. She adjusted her heart
strength and flow to compensate, and that made a noticeable
improvement. She heard the colonel's weak, strained voice say
"Ok we're now at fifty thousand feet. Ramjet in 5.4.3.2 1."
Another massive wave of pressure slammed Anne back into her
seat once more. The aircraft's already ferocious rate of climb
seemed only to increase and Anne struggled to remain
conscious, only her ability to finely tune her body stopped her
from blacking out. She managed to open her eyes and below
fell the crescent shape of the earth. Thru the viewscreen the
USA fell below her, just like a stretched out map, she could see
storms over the east coast, sun in Florida and the Atlantic
seemed nothing but a small blue lake. She had seen
photographs of it but nothing had prepared her for the awesome
majesty before her. "Colonel?" she asked in an awed tone. She
just had to tell someone, anyone.
For a few seconds the aircraft seemed level out An automated
voice called "Rocket motors in 5,4,3,2,1"
Another WHAM slammed her back into her seat and didn't let up
for what seemed an age. Of course, the G forces eased
somewhat and a few minutes later the colonel's voice came
over the intercom, "Hope you didn't black out for too long. It's
normal to black out after the ramjets so don't worry. The
autopilot takes care of things until we level out. We hit anywhere
between 16 and 17G for around ten minutes, and if it weren't for
these suits we'd be dead. Has yours deflated yet?"
Deflated? Anne couldn't remember it inflating. "Sure. Quite a
view isn't it?"
"I never tire of it. We're about to start our descent so hold on"
"Already. How fast are we going?"
"We've started to slow, but we peaked at about Mach 28"
"Fast enough then. How long till LA?" Anne said. Boys and their
toys, but this toy was going to help save her daughters life.
The Colonel's voice crackled in Anne's ear "We should be on
the ground in 15 minutes. We'll land just outside LA in the desert
and a chopper will take you where you want to go. Just give
Heinlein a call on the usual number when you're ready. It takes
about a couple of hours to refuel and check everything, so you
have to wait at least that long.
"Ok. What do I do next?"
"Hold on tight. We're about to become a hypersonic glider. "
As the aircraft hurtled at almost impossible speed towards LA,
Anne knew the reason why she had never wanted to join the
airforce.
-- o -- o -- o --
The auto-nav in Anne's car indicated that the cult leader's house
was just on the left. Anne had now worked out what she was
going to do and how. It was enormously dangerous, but she
could think of no other way. She had considered an approach
by stealth, but the clock was ticking. A full frontal assault would
be too dangerous in broad daylight, so a combination of the two
was required. She drove up alongside the large house and
checked out the tall fencing around the perimeter. There would
be infra red and motion detectors located at every point of the
garden, plus whatever sensors had been buried into the lawn.
The wall was about twenty feet high with a fine wire around the
top. Not only was this wire a sensitive alarm it was also probably
electrified as well.
What if she vaulted over the wall, ensuring she had enough
height to clear the sensors? If she used her superior speed she
could be at the front door before any guards came out. Not
having the time to do a proper reconnaissance, that was the
best she could come up with at such short notice. She parked
the car just off to one side of the house and got out.
She concentrated for a few seconds and felt her skull thicken a
little. That should provide sufficient protection against any fatal
bullets. She felt her let muscles develop and adjusted the layout
of her knee joints to optimize her jumping ability She took a
quick look around and took a few paces back and ran as hard
as she could. At the perfect point she jumped with all her
strength. Somersaulting over the wall, she landed on her feet
and then dashed at full speed towards the house.
Pressing herself against the wall of the house, she waited for the
guards to come out after her, but after a few seconds none were
forthcoming. Maybe she'd been lucky. Now came the tricky bit.
She concentrated on her middle finger and it narrowed down
into a thin bony point. She gently inserted it into the lock and by
using the nerves and sense of touch still inside her finger
adjusted the shape of the bone to fit where the key should fit.
With a click the door sprang open, withdrawing her finger, and
turning it back to it's normal shape Anne went inside. She was in
a large hallway with a number of doors on each side. A flight of
stairs led up to the first floor with obviously more rooms up
there.
To her surprise and relief there was nobody inside waiting for
her. Where was everybody? She spied a woman's coat hanging
on a nearby coat rack and she moved over to investigate. On
the collar looked to be a freshly lost hair. She picked it up and
examined it. Bingo! It still had the follicle attached to it. She
placed the hair in her hand and absorbed the follicle into her
body. Inside her body the changeling organ extracted the DNA
from the sample and learned how to generate the shape. Anne
felt her body change shape into that of the DNA donor.
She checked out her new body. She was much shorter than
before at about five six and a quick look at her arm showed that
she was now Hispanic in origin. Knowing the cult leader's
personality profile, she was probably some kind of maid. She
took the coat and put it on, it would help disguise her black
catsuit. She was surprised the house was empty but guessed
that the cult leader would soon set a whole legion of lawyers on
whoever decided to arrest him. That was much better than hired
guns, which only tended to make things worse. It was better for
her though, as she wouldn't have to deal with a small army.
Previous experience had shown Lawyers didn't bother Heinlein
as he had a way of making annoyances disappear.
Anne walked upstairs, trying to appear as though she worked
there. She tried several doors along a wide and ornate hallway.
The cult leader certainly lived well from his followers. She
paused for a few seconds, and pulled the gun out from her belt.
She tried the last door on the corridor and a smooth silky male
voice answered "yes?"
Anne walked in, the gun hidden behind her back, and saw the
man look up. The man gave a quick look at her and said "Ah,
Juanita, would you mind taking the trash out for me?"
"Certainly," Anne said, and pointed the gun at the cult leader.
"Juanita, what's the meaning of this?" the cult leader demanded.
Anne gave the cult leader a look of pure fury. This was the man
who had taken her daughter captive. "I'm only doing as you
asked. I'm taking the trash out! Now walk outside, and towards a
yellow sedan that's parked just outside. If you fuck me about
then I will kill you!"
"Juanita, why are you doing this? If it's about money," the cult
leader asked.
Anne gave the cult leader another look of deadly intent, "If you
say one more word until we get to where we are going, then I
will shoot you in the base of the spine and you will be paralyzed
for life."
The cult leader shot the woman he thought was Juanita a fearful
look. Where was she taking him? He did as he was told, walked
out of his house, and stood by a yellow sedan. The woman
holding the gun unlocked the car, and beckoned for him to get
into the driver's seat, which he then did. The woman then sat
beside him and pointed the gun at his groin.
"Now drive. If I see you try and attract attention I blow your dick
off. If you make a wrong turn I blow your dick off. If you try and
grab the gun I blow your head off. Trust me, you are not faster
than I am, don't make me prove it," Anne hissed.
The cult leader nodded. The woman who looked like Juanita
gave him several directions, until he drew up along side an old
house set away from the road. The woman took the keys from
the car and beckoned for him to get out. He was then marched
at gunpoint to the doorway, and went inside. He heard a 'night
night' and then felt a sickening thud and all went dark.
He awoke an indeterminate time later and found himself bound
hand and foot to some kind of operating table. He looked down
and saw that he was naked and exposed. He tried his hardest to
free himself but he was too tightly tied. "HEY!" he called out.
Anne walked in, still in her Juanita body, "Now you know what
Elizabeth Stephens is going thru. Where have you taken her?"
she hissed.
"Who?" the cult leader said
Anne's anger rose. Time was running out and the cult leader
was fucking her around, "Look I know you have her. Don't fuck
with me, I'm not in the mood!"
"If I knew I'd tell you. I swear on Elizabeth Bexley's life." The cult
leader said.
Anne knew he could hold out indefinitely. It was time to up the
ante. "I wouldn't swear on that if I were you," Anne felt her body
change and within a few seconds she was in her 'Friday' body
again.
The cult leader nearly fainted in shock. Juanita had just
changed into a Caucasian red head in front of his eyes. That
wasn't possible. By all the laws of biology and nature what he
had just seen could not happen!
Anne saw with satisfaction the shock on the cult leaders face.
Now it was time to ram it home, "You thought I was dead. Hah!
You have betrayed everything I ever did. Misled people into
thinking that you had all the answers, made my friends out to be
murderers and thieves."
"Who...who are you?" The cult leader stuttered.
Anne gave the cult leader a vicious stare that communicated all
her hate and contempt for him in one look, "My name is Dr
Elizabeth Anne Bexley and unless you tell me what you have
done with my daughter, mine is the last face you will ever see."
The cult leader's mind was in shock. She couldn't be alive. This
had to be a hallucination. He had seen her body before it had
been buried. That was it, he was under the influence of drugs.
All he had to do was fight it! It was the only explanation that
made sense. "You're not real."
"I'm as real as you are. Where is she?" Anne demanded.
"I don't know what you are talking about. Now let me go!"
"I don't think you realize just how pissed off I am. Look, Elizabeth
Stephens was seen being loaded into your private plane. You
have to know where she is, so tell me."
"Go fuck yourself!" the cult leader snarled.
Anne gave him a grim smile, "Now that's no way to treat your
font of all wisdom is it?"
"Hah! If you are who you say you are we don't need you! By the
time you find her we'll have our own Dr Bexley we can
manipulate as we see fit. Your darling daughter will be gone by
then, but of course you know that don't you," the cult leader's
voice was full of disdain and derision.
Now it was Anne's turn to be surprised. The cult leader wasn't
interested in her for who she was; it was all about being able to
manipulate her memory and abilities to suit his own purposes.
"I would have thought my presence here would persuade you to
let me save her."
The cult leader tried to look at Anne's face. "Not so. You know
the power of mythology. You used it all the time. Now that I've
seen you alive I see that the Dr Bexley we are creating is
much more impressive than you are. We are saving her. You
want to keep her potential bottled up, we want to release it.
What would you have done had you stayed in your father's
hospital? The world would have been deprived of your wisdom.
Of the way you forgave those that had harmed you, of the way
you managed to turn around a hopeless situation. Think about
what you would have been had you not found your true calling."
"Millions of people would still be alive," Anne snapped.
"You didn't cause those deaths. The Guild did. You stopped them.
Your greatest triumph! Have you seen the amount of lives that
following your example and teachings turned around? Just speak
to anyone who knows the truth, they'll tell you what a difference
you made to their lives. How could you deny future generations
the comfort we've brought to thousands? What I do is for the
benefit of everyone. Sure, Elizabeth will be confused for a
while but you can't let that get in the way of the dream!"
The cult leader sounded as though he was preaching to his
congregation.
The cult leader's tone made Anne feel sick. "Fuck the dream!
It's my daughter you're talking about and as for your
followers they'll manage. It's better they know the truth
than live a lie, as the truth will always come out, sooner
or later. Would those people still want anything to do with
you if they knew what you were planning? I thought not.
You preyed on the minds of the weak, the needy and the lonely.
You make me sick! Ok, this is your final chance. You know all
about my fearsome reputation and what I'm capable of."
"They were lies!" The cult leader snapped.
"No, they were true! As I was saying I'm running out of time so
you tell me where she is or I get nasty," Anne snarled.
"Idle threats," the cult leader answered back.
Anne sighed. "Ok I didn't want to do this. But you have given me
no choice. You've studied the capabilities of my changeling
organ correct?"
"There is no such thing! But yes I've read the fictional accounts."
Anne couldn't believe her ears. He was still denying it!," So
you've read about how I can extract DNA from a person and then
copy it. That was how I copied this Juanita's body, I found a live
bit of hair on her coat and used it to turn myself into her. This
feature works both ways. You may remember my little stunt of
turning fish into cats on Matthew's boat? I can channel the DNA
modification drug into a poison tipped talon so that I can
transform any living thing into any other living thing. "
"That's bullshit! Such a change would use up too much energy
and place too much strain on the body. Besides, it would play
havoc with the immune and nervous systems. I must say I'm
very disappointed in all this. Why not let me go. You'll never find
Elizabeth in time so why bother? You should be pleased that
your daughter will follow in your footsteps!"
"Not if I have anything to do with it she won't. Now hold still!"
Anne walked over to the cult leader. He looked down in horror
as a small tube grew from Anne's middle knuckle. He felt a stab
of pain in his arm and called out "Bitch!"
Anne stood back from him so he could see her once more, "My
changeling organ is analyzing your DNA. It'll take a few
moments but that's all I need," the cult leader saw Anne's brow
furrow in concentration and another small spine grew from her
other hand. Anne turned and looked him right in the eyes, her
look was one of deadly intent. and it unnerved the cult leader
more than he would have thought possible.
It then changed to a look of cold fury. She knew she
would hate herself for what she was about to do, but she had no
other choice. She just hoped he would play ball before she
moved onto stage two, "If you want a Dr Bexley so bad, why don't
you become her yourself!" She hissed and plunged the new talon into
the cult leaders arm.
The cult leader screamed as his arm went numb. Seconds later
a raging fire of pain ripped thru his body. It felt as though every
nerve in his body was being held over a flame. He felt the pain
subside in his legs but he could feel flesh rippling and his bones
rearranging themselves. He nearly passed out as a crunch of
bone reshaped his hips and then the fire increased upwards to
his body. He could bear the pain no longer and passed out.
When he awoke he felt a strange weight on his chest, and
although he was still woozy from passing out he knew that
something wasn't quite right. His mind cleared a little and he
saw right away what that something was. The mysterious weight
was two firm breasts on his chest. He screamed out loud in
shock, and found that his new voice was a delicate contralto
female voice.
"I thought you told me that DNA Modification wasn't possible.
Now where IS SHE?" Anne demanded.
"What have you done to me?" the cult leader demanded. He still
wasn't used to his new female voice.
"See for yourself," Anne said and she walked over to a small
curtain pull on the far wall. She gave it a tug and a full sized
mirror was unveiled on the ceiling.
The cult leader looked upwards and screamed again in horror.
Laying on the bed was an exact copy of Elizabeth. The woman
had long, slender but athletic looking legs. A gently curved body
with excellent body tone. The woman's head was topped by a
rich mane of auburn hair and her eyes looked upwards in abject
horror. "You bitch! You fucking bitch!" the cult leader swore.
"No not a fucking bitch I'm a 'hell bitch'. NOW WHERE IS SHE?"
Anne demanded.
"Go screw yourself BITCH!" the cult leader swore in his new
female voice. His eyes glanced downwards at the black triangle
of hair between his slender legs.
Anne gave the cult leader a vicious smile, "Yes it's gone. Just to
prove it no illusion," Anne walked over and gave the cult leader's
new pussy a gentle stroke. She felt no pleasure in it. It was just
a means to an end.
The cult leader however felt a jolt of pleasure that turned to
revulsion. It was no illusion, this woman who was most probably
Dr Bexley was touching his cunt!. "No stop it!" he demanded.
"Why, too much pleasure for you? Where is she?"
Ignoring the feelings rushing up and down his body the cult
leader snarled "I don't care if you leave me like this. This makes
no difference to what happens to her. Our goal will be achieved
and there is nothing you can do about it!" The cult leader tried to
sound convincing, but he was worried. What if he was stuck
like this? He wasn't sure he could live as a woman, and how would he
explain this to his followers?
Anne gave the cult leader a look of resignation, "Come on. You
can tell me where she is. You don't need her, you already have
everything you need. You have to admit you were wrong about
the Fury. If you tell me now I'll turn you back and you can still
continue as you were before. "
The cult leader thought for a few moments. It was a tempting
offer, but he had prepared for years for this moment. These next
few days were the cumulation of a life's work. He would and
could not give them up. "No deal!"
Anne looked into the cult leaders new blue-gray eyes, "Look!
Whatever happens, you're finished. Why destroy the life of an
innocent girl? I don't think you are evil just grossly misguided.
Tell me where she is and we can end this."
"No! I'm not throwing away a decade of work on the eve of its
greatest triumph!" the cult leader snapped.
"Ok. I've proved to you that DNA modification is possible and
that the body doesn't die when it's altered. You can feel that fact
if you just move your body a little bit and feel those tits of yours
move. In one act I've disproved everything you've said for years!
Your precious cult is as good as dead and everything you
worked for has come to nothing. You have nothing left, so let me
have her location and you can go free."
The cult leader knew that Anne was right but Dr Bexley, his Dr
Bexley would be able to turn it all around. She was his last
hope. "No I won't! Elizabeth will be able to build a new world for
her children from the ashes of this one!" His womanly voice still
sounded strange to his ears, but it didn't matter. In a few hours
Elizabeth would be his, and in any case she would be able to
switch him back in a while.
Anne was exasperated and this fuelled her anger. She tried to
calm herself down. Getting angry would lead to mistakes and
she couldn't afford that. The cult leader wasn't going to budge
from his position. With great reluctance she decided she had to
move to phase two.
The cult leader saw Anne move towards, him and take hold of
his slender arm. He saw her other hand had another talon
coming out from her knuckle. He screamed a high pitched
scream as he felt the talon plunge into his arm. Once again his
body was on fire and he passed out under the pain.
When he awoke he was dreading who or what he would
become but as he looked up into the mirror he saw his old face
looking back at him. Had his tormentor given up? He looked
down at his arm and saw tubes running out from the wrist and
on his other arm and on his chest were sensors stuck down with
surgical tape.
Anne noticed that he was awake and said, "No I haven't given
up, but I need you to be in this form for what I'm about to do.
Incidentally I've used the DNA sample I took earlier to turn you
back. Now I beg you, please tell me where Elizabeth is?"
The cult leader shot Anne a look of defiance, "Why are you
begging me? What are these machines for? You know what my
answer is going to be, so why bother asking again. Whatever
happens Elizabeth will serve the Children of Bexley."
Anne gave a look of great sadness at the cult leader. She had
been left with no choice. Part of her hated herself for what she
wasa about to do and the other just wanted to nail the bastard for
what he'd done to Elizabeth, "Ok this is what's going to
happen. Those machines are connected to you to keep you alive and
conscious and to ensure that you have enough blood to last
throughout the procedure."
"Procedure?" The cult leader was horrified. What was going to
happen to him?
"As you know I am a skilled surgeon. I'm going to take you apart
organ by organ until you tell me where Elizabeth is." Anne
spoke in a voice as though death himself was speaking.
"No you can't. There are laws!" The cult leader gasped.
"Laws that you conveniently forgot when you took my daughter!"
Anne snarled.
"No, please. I'll do anything," The cult leader whimpered.
"Then tell me where she is?" Anne snapped.
"Not that. It's my life's work!" the cult leader had regained some
of his composure.
Anne moved to one side, picked up a gleaming stainless steel
scalpel, and placed it on a tray at the foot of the table. She
ensured that the cult leader saw her pick up a number of forceps
and scissors and she put them into the tray as well. She then
picked up a small flashlight sized object. "You know what this
is? It's a laser cauterizer. When I remove an organ it'll stop the
bleeding by sealing off the wound."
The cult leader struggled to break free. He thought for a second
he could manage to free a hand but then found that it was just a
false hope. "If you kill me then you'll never find her!" he shouted
defiantly.
"Then you'd better hope I do. Now the first thing we do is make
an incision down the length of the chest," Anne's voice had
adopted a lecture tone of voice.
The cult leader screamed in pain as he felt the thin point of the
scalpel enter his chest, and the burning pain continued until he
could bear it no more. No matter how hard he tried he couldn't
relieve the pain by passing out. More pain wracked his body as
through eyes slitted in pain he felt his torturer slowly peel back his
flesh until his layer of muscles were exposed.
Anne pinned back the cult leaders skin so it formed a thin,
translucent sheet going from outside of the cult leaders chest.
She ignored the amount of blood that was seeping out of the
skin. That was a small amount compared to what would come.
Anne said, "Whenever you are ready to tell me just say stop!"
She then paused for a few seconds and said, "Not ready to tell
me yet? Ok, let's make a nice cut through all that muscle, shall
we? Actually, the cut will be from mostly your rectus abdominus
muscle down to your conjoined tendon,"
The cult leader felt another wave of indescribable pain as in the
mirror he saw Anne run the scalpel down the length of the
muscle covering him. He felt himself retch and he turned his
head sideways so that his vomit wouldn't choke him.
Anne watched the cult leader throw up all over the floor.
"Thanks, that will make your stomach easier to remove," she
hissed.
The pain was continuous now. There was no let up as wave
after wave of it crashed thru the cult leader's body. The pain had
started to confuse his mind, but one thing he knew -- he had to
hold on. Elizabeth was his last chance.
"Where is she?" Anne asked.
"Not.. saying.," the cult leader said. Lashings of pain interrupted
each word.
"Have you ever seen a spleen? I have," Anne asked the cult
leader.
Anne smiled and picked up her scalpel again. The cult leader
felt Anne's hand inside him and he closed his eyes, waiting for
the pain that was sure to come.
"I'm about to cut thru the spleen's fibrous coat and splenic
artery. Anything you want to tell me?" Anne said. She had
switched off all her emotion. One thing fixed in her mind, she
had to get to Elizabeth as soon as possible!
"Go... To Hell, " the cult leader said hesitantly. He felt a small cut
inside him and another level of pain was added to that which he
already felt. The pain wasn't sharp but a growing wave of dull
agony. He opened his eyes and wished he hadn't as he saw his
chest open and awash with blood. His skin and muscle had
been pulled apart and pinned open by clamps.
Still in her lecture tone of voice Anne said, "Did you know the
average length of a human small intestine is about 23 feet?
Let's find out, shall we. Unless of course you want to stop."
Mustering all his strength the cult leader managed to say, "No,"
there was more at stake than his life.
The cult leader cried out in pain as he felt Anne make another
incision inside him. Pain turned to revulsion as he saw her lift
out a long yellow, fleshy tube and hold it in front if his face. He
nearly threw up again but somehow he couldn't. He saw Anne
reach towards his small intestine with some surgical scissors
and all of sudden another hammer blow of pain struck him. This
wasn't the sharp, immediate, screaming kind that he had felt,
before but one of utterly intensive, overwhelming, and
continuous agony.
"That's one foot," Anne said, discarding a small piece of
intestine on the floor.
The cult leader screamed in pain as another wave of this dull
but intensive pain crashed thru his body. He tried to bend
double, to somehow relieve the almost unbearable agony, but he
was held firm hand and foot. His, body, unable to relieve the
pain, just added more and more intensity to it in ever increasing
magnitudes.
"Two feet," Anne said gently.
Just as that scream died in his throat another way joined it as
another wave of intense agony crashed thru his body.
"Three feet, Only twenty more to go," Anne said gently.
Another loud scream pierced the room as he felt the
agony of another cut, and another, and another, and so the pain
and screams went on until he could bear no more. He thought of
the harm this evil woman would inflict on his precious child if he
gave in. It gave him the strength to hold out a little longer.
"Hmmm, your small intestine was only 22 feet in length. Never
mind, size doesn't matter, or so they say," Anne said with a
vicious smile. She continued on in the same tone, "Now I didn't
really think you'd have the stomach to hold out for so long.
Maybe that's what's next. Come on, where is she? I'll stop if you
tell me."
"No," the cult leader gasped. Part of him wanted to end the
torment his body was going thru. Every nerve in his body was
screaming in pain, like nothing he had ever experienced before.
He couldn't help but look at his gaping chest in the ceiling
mirror, and he tried once more to vomit, but there was no release
from the pain and horror. He felt Anne's hand go inside him
once more, and the now familiar stab of pain crashed over
him again, exceeding that of the agony he now felt.
Anne pulled out a large reddish blue object and showed it to the
cult leader, her hands dripping with blood, bile and gore. "Now
I'm going to cut thru the gastric and fundric zones into the
gastric folds."
The cult leader looked on in horror as Anne cut a slit in his
stomach. The look turned into a blood curdling scream as she
poured his stomach contents into his chest cavity. More pain,
agony, and horror than he could imagine wracked his body as
the acid and bile ate into his remaining organs. It felt as though
a million hot needles were being stabbed into every part of his
chest. Another massive scream erupted from his mouth as he
felt the acid eat deeper into him. He stole a look upwards into
the mirror and saw that the blood had been cleared away a little,
and now in it's place was a greenish liquid, mixed in with the
deep red of arterial blood. Nothing was worth this much pain. It
had to stop. It was too late now anyway. His Dr Bexley would
come to into being whatever he said. He had won! "STOP!" he
screamed as loud as he could but it came out no more than a
whisper.
"Where is she?" Anne demanded.
"Gilcar Farm, near Park Mill, Yorkshire, England. But it's too
late," the cult leader gasped.
"See. You needn't have gone thru all that pain need you?" Anne
said soothingly. She turned away from the cult leader and went
to walk away. As she did so she concentrated hard and felt a
tube form from her wrist. She had to be careful as a single bony
dart grew inside it. What it contained was not to be messed with.
"Please, cure me!" The cult leader gasped in pain. The pain had
still not subsided, and if anything was growing in intensity.
"My pleasure," Anne said and fired her dart at the cult leader. It
struck him clean in the neck and seconds later he gave a loud
gargling scream.
Anne looked on, as the cult leader's body seemed to go limp.
Bulges of fluid formed under his skin, which then ruptured
spewing a pink, semi solid fluid all over the floor. With one last
scream the cult leader seemed to deflate as more and more of
his body dissolved into more and more of the pink fluid.
Seconds later the pools of blood that were on the floor were
mixed in with the remains of the cult leader.
Anne turned around and fled out of the house. Not only because
it was a race against time, but also because the full reality of
what she had just done had just dawned on her! She had acted
without mercy and without remorse. As she climbed into her car
and sped towards where the chopper had landed she suddenly
felt as though she had become a monster once more. She tried
to justify what she had done by telling herself that it had been
required, and that taking down the bad guys in order to save her
daughter was an acceptable thing to do.
Maybe if she had used minimal force she could have justified it,
but this was by no means minimal. Somehow she had allowed
herself to be consumed by anger and worry for Elizabeth's
safety, such that her actions had become second nature. One
thing was for certain. Mark would never have her back now, and
the way she felt now she wouldn't blame him. She truly was
death incarnate. What in hell was she thinking when she'd had
planned the whole thing out in her mind? One thing was for
certain, Heinlein would be mad at her! And yet, as he had
authorized the use of lethal force, what did he expect! That
thought caused her more concern. A part of her had enjoyed
performing the act of death by vivisection on the cult leader. He
had systematically taken apart her whole life and built it into a
lie. It was fitting that she did the same back to him.
Anne shook her head, to clear it. What in hell was she thinking?
Even in her most vicious times of insanity she had never acted
in this way, and yet, she was now supposed to be cured! She
hadn't changed one little bit. She had used excessive force on
Hassan all those years ago, several times when working for
Heinlein and now, when she was living her new life as Anne
Baxter, she had ripped apart those gang members who had
threatened her and Mark. Now this had happened and this was
the worst of all. She had used her medical skill to kill someone
bit by bit! It didn't matter that he was one of the bad guys; she
had no right to do that to him. The thought only made Anne feel
worse, but it was too late, the deed had been done and now only
remorse remained.
She thought of dear, sweet Mark back at college. Perhaps she
had been right to leave him, in spite of her feelings for him.
Maybe she was just too evil to love. This made her feel even
more depressed. Anne spoke to her car hi-fi, "Car track 19
personal collection," the in-car hi-fi beeped and began to play.
"In my dreams I'm dying all the time
As I wake its kaleidoscopic mind
I never meant to hurt you I never meant to lie
So this is goodbye.
This is goodbye
Tell the truth you never wanted me
In my dreams I'm jealous all the time
As I wake I'm going out of my mind
Going out of my mind."
Anne didn't feel in the mood for music. "Car music off!" So she
tried to put the thoughts out of her mind, instead focusing on the
mission ahead. Within minutes she would be at the helipad and
within an hour and half in English airspace. Now all she had to
do was hope and pray that Elizabeth could hold out.
-- o -- o -- o --
Flight BA7877 carrying an extremely worried Kat was just over
India as Anne's 'lift' was hurtling towards England. She was
sitting back in her seat trying not to worry but failing miserably.
She hadn't been this worried since she had been kidnapped by
the guild all those years ago. Now once again she would have
to dig deep within herself for the trials that were sure to come.
She had tried to get hold of John but he was out with his friends
hiking in the Australian outback and his PDA wasn't turned on.
What did the people who had taken Elizabeth want from her? Or
even from them? If it was money, that wasn't an issue. What if it
was something else?
Her blood froze as a thought crossed her mind. They didn't want
money. Matthew had told her that. What if they wanted
Elizabeth? What if whoever took her knew that she really was Dr
Bexley's daughter, not their own? What if they thought that they
could make Elizabeth into a kind of Dr Bexley re-incarnation?
Her PDA bleeping interrupted her train of thought. She fished it
out of her jacket pocket, untangled the earpiece, and put it in her
ear.
"Yes?" She answered.
"Hi it's me," Matthew answered.
"Any news?" Kat blurted.
"Not really. I just called to see how you were."
"Bearing up. I'm going to get there too late aren't I? Why in hell
do we live so far away from everything? I've not even crossed
India yet. I'm too old for this kinda crap now." Kat eyes started to
fill with tears.
"I know what you mean. I've called the FBI and the Brit police
and they tell me it's all under control and not to worry. Alex is
resting now. He's been beside himself with worry. He's on the
front line and he's only a kid!" Matthew said softly
"Not much younger than you were when SHE did all that stuff to
us. He'll cope. We've got each other no matter what happens.
As long as we stick together like we always have we'll be ok."
Kat tried her best to sound convincing, but why did she doubt it
herself?
"I guess so. At least we knew who our enemy was," Matthew
commented.
Trying to sound a lot braver than she felt Kat replied "The
enemy is always the same no matter the situation. Fear is our
enemy. It robs of our power to think and to reason. It destroys
the bonds of trust between us, saps us of our energy with which
we fight. Matthew, we need each other, Cathline, Alex and John.
All of us together must face fear and overcome it. If Elizabeth is
to live then that is the only thing we can and must do."
"Thanks Kat. I have to get off the line now, just in case. I love
you more than I can ever express or say or do."
"I know. I always have known, and I feel the same way about
you. Love you," Kat replied tearfully.
"Bye," Matthew replied softly. This wasn't over yet, not by a long
way.
-- o -- o -- o --
Elizabeth struggled to get her eyes open. Her head ached like
hell; she was feeling so woozy and so confused. As her mind
cleared a little she realized she was sitting down in a chair. She
tried to get up, but found herself unable to move. She managed
to get her eyes open but could make nothing out in the darkness
of the room. Suddenly a bright white spotlight flooded the area
where she was sitting, momentarily blinding her. "Hey," she
called out.
The rest of the room remained dark, and even after adjusting to
the light her eyes couldn't make out any detail in the shadows.
She glanced down at her hands and saw they had been
securely strapped down, as were her legs. She was clearly
going nowhere. "Where am I? What you going to do with me?"
she called out. Her voice showing her fear.
Again there was no reply from whoever was holding her but in
the back of her mind she heard Deianeria say, "Now it's time."
"Time for what?" Elizabeth whispered.
"My Time," was Deianeria's cryptic reply.
A heavily disguised voice came from a speaker somewhere in
the far corner of the room. "Welcome, precious daughter. Now is
the time for you to take your rightful place amongst us. Your old
life is over, your new one is about to begin."
"Who are you? What do want? Why am I here?" Elizabeth
demanded. They had called her 'precious daughter'. The phrase
sounded familiar. Suddenly it came to her. The Children of
Bexley cult were holding her captive. What did they mean her
old life was over? There was no way she was going to join them!
The voice spoke once more "We have prepared for years for
this day. You have prepared for it your whole life!"
"What are you talking about?" Elizabeth demanded. She could
see no obvious way out. Deianeria had promised to help, to
protect her maybe she could help?
"Deianeria?" She whispered to herself.
"This is my time, yours has almost gone," Deianeria whispered
back, echoing what the voice had just told Elizabeth. Elizabeth
then felt a dark murky oppression in her mind. Like a headache
coming on, only hundreds of times worse.
A feeling of dread and fear ran thru Elizabeth. What was
Deianeria playing at? She had trusted her, listened to her advice
and handed over her protection to her. Now it seemed as
though Deianeria was trying to take over! Her ears picked up the
sound of someone walking into the room, but she couldn't make
out any more details than that.
A thought struck her, Angela! What had they done to Angela?
"Angela is she.." Elizabeth called.
There was no reply and suddenly the lights dimmed for a few
seconds and then blazed back on again. For a few more
seconds Elizabeth was disorientated, but she could make out
the shape of the person who had entered the room. It was
female and about five feet nine with black hair. As the details
became clear she saw the woman's face. It was Angela!
"Angela, you're OK! Quick, let's get out of here!" Elizabeth
screamed.
"Hello Elizabeth," Angela said coldly.
The realization hit Elizabeth like a sledgehammer. Angela
wasn't here to help her at all! She was involved! She felt
physically sick at Angela's betrayal. She tried to speak, but all
she could hear in her mind was Deianeria's manic laughter. Her
mind whirled with confusing thoughts. Firstly sadness then
anger and more anger at being betrayed by her best friend.
"Angela why?" she sobbed.
"It's what I was trained to do. We have plenty of time so I will fill
you in. The more I tell you the more you will free yourself and
your potential."
"You lied to me!" Elizabeth cried out, enraged.
Angela gave Elizabeth one of her sweet smiles "I've done more
than that. In a few hours, you will be who you were always
meant to be. "
"Stop saying that! I'm meant to be me. I'm meant to marry Alex,
I'm meant to be a doctor," Elizabeth anger rose with every
passing moment.
"One of out three isn't bad. You are meant to be a doctor, but
not the doctor you thought you were going to be."
"Bitch! I'll resist you. I won't do it!" Elizabeth now added hurt and
pain to her anger.
"Yes you will. Simply because you have no choice."
"I always have a choice."
"No you don't! Let me explain. My real name Is Angela Adams,
but I'm afraid I'm not adopted. My father is James Adams and
my mother was just someone he liked the look of."
Adams! That was the same surname of the cult leader of the
Children of Bexley, "No you can't be!" Angela was the daughter
of the Cult leader James Adams. She had revealed her
innermost secret in exchange for a lie. Another betrayal of trust!
"I was trained from the age to ten to be able to think like you do,
to know what you most wanted in a friend, and know every
thought, word, and deed you were going to do. I know you better
than I do myself. I was trained to be the perfect friend to
Elizabeth Cathline Stephens. It's what I was born to do! When I
read where you were going, my father ensured that I would be
your room mate. I was to be the tool that would unlock your
potential. I did like you, Elizabeth, which made it easier for me to
be your best friend. I couldn't have been so effective otherwise!
But soon you will be gone, and a new you will be born. We can
then start off our friendship again, brand new, with no hard
feelings and no secrets from each other!"
Elizabeth was about to say something when Deianeria's giggling
swamped her thoughts and nearly overwhelmed her mind.
"Stop it!" Elizabeth shouted to herself.
"I see it's working. The true you is breaking free. Soon you'll
be the person to lead us into personal nirvana, you'll know the
answers to all our problems and be wise enough to help us deal
with them. Just think of all the people's who's lives you'll
change for the better."
Elizabeth tried to ignore the oppression in her mind but it
Was rapidly becoming worse.
Angela continued to speak, "Just think, after you are free,
we can be together just like we used to be, as best friends,"
Angela smiled as she had done so many times when she and
Elizabeth had been roommates.
"Fuck off!" Elizabeth snarled.
"Your whole time with me was carefully staged and managed.
Remember the trip to Ely to play a joke on my dad? That was
my idea wasn't it?"
Elizabeth nodded, unable to think straight.
"That was designed to do two things, firstly to show you off to
our followers and secondly to start to unbalance you. To drive
doubt and fear into your mind and into your heart about who you
really were. We needed to see if you really had the potential to
be who we knew you were all along. Your outburst and subsequent
elation at being praised told us everything we needed to know. I
had to move slowly and carefully. Move too fast and you would
suspect. We had to move softly, and a bit at a time or else all
would be lost. All those picnics, coffees, and late night chats
were designed to gain your trust. Let you open up to me,
'Dearest Angela my best friend in the whole wide world'." Angela
gave another mocking smile.
Elizabeth was still unable to think. Deianeria was now silent and
inside her the feelings of betrayal fed upon those of hurt and
pain and those of hurt and pain fed upon betrayal. The dark
oppression in her mind was gaining in strength and ferocity.
Elizabeth found that by concentrating she could keep it at bay.
"Ever wonder why your medicine has been having such little
effect recently? By now how you are is your natural state of
mind, so I doubt you gave it much thought. From the first day we
spent together I have been replacing your Olanzapine with a
drug of our own making. You thought you had stopped taking
Olanzapine for only a few days. In fact you have not had any for
over six months. My little helpful trips to fetch your medicine
were just an excuse for me to bring in new supplies of our own
drug. Olanzapine suppresses who you really are. We could not
allow that to happen again."
"What was the drug?" Elizabeth managed to say, her voice full
of fear, the fear that had for the moment replaced the fury. What had
been done to her?
Angela gave a cruel smile. "Dose by dose it built up your
resistance to Olanzapine or any other treatment you might take
to prevent the real you from taking hold. In order to suppress the
new you, you would need to take so much Olanzapine it would
kill you. You can never be rid of the new you. She will always be
there in your mind. Not that the drug will be required after today
anyway."
"What's going to happen to me?" Elizabeth stammered.
"That would be telling. Remember Nick? He was another trigger
I set in place to put you off balance. To put pressure on the
fragile old you to make it easier for the new you to come out."
"Nick was a set up?" Elizabeth sobbed. She tried to close her
eyes and remember the fun times they had had together,
anything to get rid of the constant stream of betrayal and hurt.
"Ever wonder who the 'other woman was?' it was me! You thought
yourself so aloof and superior, but it was me who stole him away
from you He was a set up. And you're supposed to be the clever one.
Everything was a set up."
"Did I kill him?" Elizabeth asked, fearful of the answer.
"He was already dead. As soon as he went out with you his fate
was sealed. I did the deed myself. I must say, for a man of his
size he was an easy kill," Angela voice was emotionless as
though she had just described stepping on an ant.
Elizabeth gave a loud cry. She hadn't had him killed, but she was
responsible for his death. It hadn't just been a mugging, it was
another step in the plan to get at her. She felt the dark stifling
pain of Deianeria move closer into her mind, threatening to snuff
her out at the slightest chance.
"When dad came to you with the receipt and told you to look at
the facts, that was to make you look into yourself. By now we
had applied enough pressure for your new personality, the real
you to start to show thru. You responded brilliantly, even better
than we imagined you would. Your little quest served to divert
you away from our real intentions, blindside you so that when
we took you it would all be a surprise. It also freed your mind to
allow the real you to surface. We had a cleaner plant the fake
journals at your parent's house. Did you know that I wrote them?
It took me years to perfect Dr Bexley's handwriting, by the way.
By the time you came back from vacation your mind was a
battle ground between Elizabeth and the person you call
Deianeria."
Elizabeth gasped. How did she know?
"I heard you talking to her during the night. I lived and breathed
every moment with you, remember. It was when I heard you
refer to Deianeria that I knew our plans were working. The
months of constant pressure and diversions were beginning to
work, that combined with the lack of Olanzapine. You were
starting to become who we wanted you to become. The real you
is Deianeria. I'm sure she's in there right now forcing her way
into your conscious mind," Angela
Elizabeth stayed silent. Deianeria was getting harder and harder
to suppress. The more Angela revealed her betrayal, the more
she inflicted hurt and pain on Elizabeth, the more difficult
Deianeria was to stop from swamping her mind and taking over.
She then realized that was that they were planning to do. In her
confused and distraught state it had taken her longer to reach
that conclusion than it should have done! She needed
something good and solid to focus on. If she could manage that
then she would be able to resist. She remembered back to her
first date with Alex and their first kiss. The shivers of delight it
gave her and the thought of her marriage to him raised her
spirits and helped keep Deianeria at bay.
"If you are wondering why you felt so woozy it's because the
effects of the CAT scan are just wearing off," Angela noted with
medical precision.
"CAT Scan?" Elizabeth said. She was still trying to focus on
Alex.
Angela checked her watch "Yes, it should have gone out by
now. You see while you were unconscious we flew you to France,
took some blood tests and a CAT scan and while you were being
moved back here we compared them to the treasured Dr Bexley.
They confirmed what we already knew, that you are her
daughter, and not Matthew and Jane Stephen's. We've sent that
and all our other evidence to several international news
organizations. I suspect in a day or so the whole world will know
the truth about you. It'll take them a while to verify the story,
but rest assured the truth will get out. I wonder how would your
beloved Alex react to you then?"
"NOOOOO!" Elizabeth screamed. From now on she would be
an outcast. Looked upon with fear and distrust wherever she
went. All her nightmares about being hounded in the press,
watched by the police every time she went places were coming
true. She didn't even now have the luxury of being able to give
people the comfort of her being on Olanzapine, as she was now
unable to use any form of treatment. Angela was right. What
would Alex say? She hoped that he would stay with her, but she
couldn't guarantee that. Her only chance was to stay in exile on
her parent's island, but what kind of life would that be? She
would be unable to go out, have a career. She would effectively
be in prison. She could feel Deianeria start to push thru the
barriers she had erected. How much more could she stand
before she gave in, before Elizabeth Stephens was gone,
consumed by the person called only Deianeria.
"I see you see the reality of your situation. You can either stay
with us and we'll provide everything you need. Friends, a career,
people who love you, or you can be hunted down everywhere
you go. Sure in time the press coverage will fade but every job
you go for, every friend you make will know of what you are
capable of and who you are. Your other choice is to go it alone,
trying to make a life for yourself as best you can. I know how
hard you find it to trust people, think how much more difficult
that will be now."
Elizabeth pushed down her anger and sadness. "There's always
Alex, Mom and Dad, John and Cathline. I don't need anyone
else!"
"Ahh yes family. The last refuge of the desperate," Angela's
voice was deathly quiet.
"What are you going to do to them?" Elizabeth asked fearfully.
She could no longer think in any detail any more. Although
Deianeria was silent, she could feel her oppression in her mind.
It was slowly and inexorably strangling the life out of her. She
couldn't take much more of this. Was oblivion better than the
living hell she had been exposed to now? It was certainly
tempting, all she needed to do was let go, Deianeria would take
over and she would be gone. Her love for Alex and her family
was her last stronghold. Nothing Angela could say or reveal
could knock down its walls. "If that's all you've got Angela,
you've failed. I'm still here!" She said, mustering all her defiance.
"Oh no I've saved the best till last. I'm going to tell you this now
but the rest of the world won't know until your wedding day, if it's
still on that is. The beloved Dr Bexley only revealed her true self
when her wedding was ruined. We're going to do the same for
you."
"How? Alex won't leave me. You can't deny his love for me,"
Elizabeth said triumphantly.
"True but the law can," Angela replied. Her voice revealing that
she was going to relish the next part.
"The law. The law can't touch us! Neither of us are married!"
Elizabeth saw the look of supreme confidence on Angela's face
and her concern grew. What did Angela know? What could
Angela possibly know?
"I'm afraid the law expressly forbids brother and sister to marry.
Whether Alex loves you or not, it doesn't matter a single bit. You
are his sister." Angela gave a broad smile.
"No you're lying!" Elizabeth sobbed. She had to be lying! Alex
wasn't her brother, how could he be? She felt the tendrils of
Deianeria's presence start to infiltrate into her final stronghold.
She dug down within herself, drawing on the last reserves of
strength. Her final hope that Angela was lying.
"No I'm not. You see we worked it out years ago. We know
every word Cathline wrote in her books. You will too when you
join us. The key section came after Cathline was kidnapped by
the Guild again and handed over into Osman's care. He had
burned her eye out again and left her chained hand and foot to
the wall. Let me quote Cathline's words to you
'I was exhausted and tired. Osman had just burned my
eye out again. Supposedly repeating the punishment he
had inflicted on me all those years ago. Inside I ached
and I could still feel the sickening feeling of violation
from when one of Osman's bodyguards had decided he
would be the first man to fuck Rachel Martin. I had tried
to resist but he was too strong for me.
I can't remember too much about my time chained to that
dungeon wall. It brought back too many horrific memories
of my time in Osman's dungeon where I had been raped
every day for four months. Tina would hurl abuse at every
man who came in to take me, she tried to attract his
attention away from me but it didn't work. They always
came for me. My eye still gave me incredible pain and
there seemed to be no end to the cycle of rape and
violation. I had to hold out, no matter what!
That was until Salah came in. I took one look at him and
sighed in resignation. Tina was hurling abuse at him but
he just ignored her and started to screw me. He wasn't
like the others. He seemed kinder, gentler, as if he really
cared for me. He touched me in places that I had only
told a few people Kat, John, and Dr Bexley, I liked to be
touched.
My spirits rose when he told me he was going to get us
out. I knew he was going to take me whatever I did so I
relaxed and let myself enjoy it. After he had come inside
me he gave me a single fingered salute and left.'
Angela set the book down, and smiled coldly at Enizabeth.
"Who was Salah at that time? It was your Mom, wasn't it? She
was a fully functional man at the time. We know from Guild
archives that Kat was the only person to screw Cathline during
her time in that dungeon. Cathline never was never serially
raped in that dungeon! If you work back the dates then nine
months from the date this occurred is Alex's birthday. That's why
he's got an Arabic look about him. He's what, four months older
than you are? Strange timing don't you think? Alex is your
brother and we are going to reveal that to the world on your
wedding day."
"Please you can't. No, anything but that! I'll do whatever you want,
anything but that," Elizabeth sobbed. Her mind was so
confused. She didn't know what was real anymore!
"Your parents and Cathline must have known. Cathline did!
That's why she lied in her book! To try and fool people, but it
didn't fool us. Your Mom as Salah protected Cathline from
being raped but Cathline covered it up! They lied to you
Elizabeth, and they weren't going to tell you. You would have
been illegally married to your brother and they weren't going to
tell you. What does that say about them, Elizabeth? You can
tell how people really feel about you by the way they treat you. I
bet they never kept things from John did they? How can they
love you if they can do that you? You're not even their real
daughter are you?"
Elizabeth's eyes glazed over and she gave a blood curdling
scream and then slumped almost lifeless in her chair. Deianeria
had finally breached her last line of defense.
-- o -- o -- o --
Anne decided to walk the kilometer from Park Mill to Gilcar
Farm. It would be much safer and allowed her time to gather her
thoughts and refine her plan. She positioned herself on the
road just above the old ramshackle farmhouse and put her infra-
red binoculars to her eyes. It took a few seconds for the
readings to show but she saw a single figure, apparently sitting
down, outlined in yellow and orange in the middle of a room and
another figure standing near it. The figure sitting down must be
Elizabeth. She scanned the surrounding area for more figures
but saw no one. As she suspected the cult had relied on
secrecy and stealth rather than brute force. Having hundreds of
armed guards running around would attract attention where
single figure in a remote stone clad farmhouse wouldn't even
raise an eyebrow.
She flicked a switch on the side of the Binoculars and the view
turned from orange and yellow blobs to an eerie green glow.
She zoomed into the surrounding countryside and the scanner
built into the viewfinder showed that there were no transmitters
or electronic devices around. The farmhouse was protected only
by the stealth and secrecy afforded it by a fanatical group of
people, which as Anne had to admit was often the most difficult
to crack open. Another potential complication was the fact that
the Children of Bexley's organization and execution of the
kidnap was amateurish at best and at worst very dangerous.
There had been no cover for the cult leader, and now no cover
for where Elizabeth was being held. It was clear that the cult
wanted to keep a low profile and that was the reason for the
lack of backup. In a way, what was more worrying was the fact
that it was easier to deal with 'professional' hostage takers than
amateur ones. Anne was under no illusions that if the Guild,
back in their heyday, had taken Elizabeth captive things would
be a lot different.
Switching back to infra red, the figure standing up moved out of
the room and into a side room. Whatever had been going on
had either paused or had been completed. Anne prayed it was
the former. The figure sitting down was still showing a healthy
orange glow, so Elizabeth was at least still alive. Anne stood up
from her crouch and as she did so the pistol she was carrying
dug into her leg. It was a painful reminder of the task she was
ordered to perform should it be required. She had no choice but
to carry it out. If she failed then someone else wouldn't. There
had to be another way, didn't there?
As quietly as she could, using low cut stone walls, farm
machinery, and bushes for cover she crept towards the house.
She crept to one side of a ground floor window and pulled out a
metal tube. Unscrewing the lid she ran a small line of white
paste along her side of the window. Ducking down she did the
same for the base of the window, ensuring the paste met the
other line she had just squeezed out. Within a few moments the
entire glass of the window had a white rectangular paste line
around it. From her backpack Anne pulled out a small metal
cube and bracing herself under the window pressed the cube
into the paste.
A few seconds later the paste started to fizz and glow red hot.
Anne braced the window as the rapidly heating paste melted the
glass around the window. A few moments later the glass fell into
her hands. She held the window for a few seconds, allowing the
glass to cool before she placed it on the ground beside her.
The police would think it was how the kidnapper had gained
entry.
Checking with her infra-red binoculars that the kidnapper was
still in another room, she climbed inside. Stashing her binoculars
in her backpack, she listened for any signs that she had been
heard. Satisfied that she was undetected; she concentrated on
her left arm. Within a few seconds, a small hollow tube about six
inches long grew from her elbow and out of her knuckles. Inside
the tube she could feel the darts containing a powerful neuro-
toxin start to form. It wouldn't kill, but it would paralyze for
several hours and leave no traces in the bloodstream.
After creeping into the hallway, Anne paused for a few seconds,
checking again that there was no sign of detection. She heard a
faint sound coming from a room to the left. Quietly and quickly
she edged herself along the side wall. The sound grew louder.
Whoever it was coming out of the room! Anne readied herself
for action, and waited, holding her breath while the door slowly
opened and a figure stepped outside.
Anne watched the tall brunette walk out of the room, tray in
hand and with her dart arm took aim. She stepped out of the
shadows and said, "Hello there."
Angela jumped in shock, dropping the tray in the process, and
stared at the tall red head waiting in the shadows. She heard a
slight hiss, then a jab of pain and she looked down at her
shoulder. A large thorn was sticking out of it and within a few
seconds her head span and it all went black.
Anne stooped down over Angela's paralyzed form and slung her
over her shoulder. She didn't want her waking up and getting
help. For a moment she considered putting a bullet in her head,
but then decided otherwise. She would determine Angela's fate
once she had checked out Elizabeth.
Trying to visualize the layout of the house in her mind she took a
right turn into a large room. The featureless walls were painted
jet black, and the lights were full on, giving the room a cell like
appearance. In the middle of the room, slumped in her chair sat
Elizabeth. Dumping Angela in the corner, Anne ran to
Elizabeth's unconscious figure, "Elizabeth are you ok," Anne
asked, checking Elizabeth's pulse. It was strong and regular.
Elizabeth, however, did not look ok. Her hair was tousled, the
area around her eyes was streaked with tears, but when all was
said and done she looked uninjured. Anne breathed a sigh of
relief. All she had to do is wait for Elizabeth to wake up.
She took a few moments to study the face of the daughter, she
had only seen in magazine articles. Of course she looked
exactly like she used to. Auburn hair framing delicate
cheekbones, full lips, and even in sleep she had an aristocratic
air about her. Anne gently gave Elizabeth's cheek an
affectionate stroke. This was her daughter, a daughter she had
left in the care of others worthier than herself, and a daughter
she had never known. What would she be like? Would she be a
smart, self-assured young woman as she was at her age, or
would she be a timid little mouse? Anne knew that Elizabeth
would be brilliant, but that was no compensation for not knowing
her properly. Of course Elizabeth wasn't the product of a loving
union, but of genetic engineering. To Anne, that didn't matter
one bit. Anne imagined the baby Elizabeth in her cot, cooing,
gurgling, and smiling at Matthew and Kat. And she felt bitterly
sad that she was not around to see it. Now Anne gave Elizabeth's
hair a comforting and loving stroke. When Elizabeth awoke
Anne would be forced to decide whether she lived or she died.
Anne concentrated on her wrist and the dart tube retracted back
into her arm. She then sat crossed legged on the floor, gun in
her right hand, and waited for Elizabeth to wake up.
-- o -- o -- o --
Mark had spent the last few hours trying to forget the night
before. How quickly his fortunes had turned around. One
moment he was the luckiest guy in college, the next his girlfriend
turns out to be a mass killer. No matter how he tried he couldn't
get the images of her cutting down the gang in front of his very
eyes out of his mind. More than that, she had shown little
remorse in doing so. Forget about Dr Elizabeth Anne Bexley
being a reformed character. She was just as lethal as she had
ever been, maybe not psychotic anymore, but deadly all the
same.
It had taken a lot of courage for her to admit who she was, but
she didn't really have any choice after what she'd done. He
would have sussed it out sooner or later anyway. Now he
thought of it, all the background information he and Wills had
got on her fitted in perfectly. No illness of any kind, her
changeling organ could quickly deal with any infection. Her high
intelligence, her extreme confidence in dealing with the boat
accident, her parents being killed in an auto accident, and her
taste in retro-music should have all been clues. But how could
anyone still suspect that the infamous Dr Bexley was alive and
well?
She had joked about only picking up men in broken down cars,
and he'd thought it had related only to him, but no, clearly it
didn't. He had to tell someone about this, his heart couldn't
contain the hurt he felt, and he had to share it. Wills would know
what to do.
Picking up the phone he called Wills ,"Hi Wills, where are you? I
need to talk."
"Right outside your door. Hey, you missed classes today. I was
worried you ok?" Wills voice answered.
"Tell you when I let you in." Mark got up and opened the door
just as Wills was walking down the hallway. Putting the phone in
his jeans pockets he gave Wills a wave.
"Hi, wass up?" Wills asked.
"Take a seat and swear to God you won't breathe a word of this
to anyone," Mark said softly.
"Ok, " Wills replied and sat down on the threadbare sofa.
"Anne and I split up last night," Mark said. It still hurt to think of
it.
"Oh no! I thought you two were so right for each other. How
come?"
Mark related the previous night's events to a stunned Wills.
"So Anne was Dr Bexley all along, complete with changeling
organ. Fucking hell, Mark you're lucky to be alive," Wills
commented.
"I know, I kept expecting her to rip my head off, or turn me into a
cheerleader or something. I've no idea where she is but I'm
staying here until this all dies down."
"No, I didn't mean her. I meant the gang. If she hadn't
been there you would have been dead on the pavement with a
bullet in your head. She saved your life, Mark," Wills said in a
matter of fact tone.
"I know, but she didn't have to rip people in two. That was
before we broke up anyway." Mark was now feeling even more
depressed. How could this happen to him?
"How was she when she left?" Wills asked.
"She didn't seem angry at me as such. Just sad that I didn't
want to be with her anymore. She told me she loved me. If she
had told me that before yesterday, I would be on an all time
high. But now I feel as though my heart has been broken into a
million pieces. She was so right for me Wills. Why'd it have to
work out this way?" Mark was trying his hardest not to cry but
his pain was starting to push through.
"When she told you about the Fury, did she seem sorry for it?"
Wills asked.
"I can't tell. I was too much in shock," Mark admitted.
A thought occurred to Wills and he voiced it to Mark "You know.
She could've begged forgiveness, tried the sympathy thing on,
but it looks like she didn't. That says something to me."
"Yeah, like she was sorry she got caught!" Mark snapped.
"No, like she wanted to be honest with you. She wanted to show
you who she really was, not manipulate your feelings to get
what she wanted. She's lived her entire life being other people,
now she only wants to be herself as best she can. Before you
knew who she really was you treated her like that. With no
pretensions, images or masks. From what you told me about
your first date that's what she said she liked about you. You
didn't try and be anyone else, just Mark."
"I really fucked up, didn't I?" Mark complained bitterly.
"That depends. How do you feel about her?" Wills asked.
Mark shrugged his shoulders "I don't know. Anne Baxter I fell in
love with. Dr Elizabeth Bexley I haven't. Yes I know they are the
same person, but last night, when I looked at her I didn't see
Anne. I saw a fifty year old woman, who isn't strictly human, and
who had just killed three people as though they were bugs to
step on. That's a big change from the person I thought Anne
Baxter was."
"I hadn't thought about the age gap," Wills admitted.
"I only just did. Sure, she looks my age, but in her mind and the
way she acts she's just like my Mom! Sure, she wears the
fashionable clothes and acts like a normal twenty something but
all the way along there was a world weariness about her. I never
really noticed it until you said, but it was little things. Like the
way on her first date she acted as though she had seen it all
before. I'd put it down to her having lots of dates, but now I know
she HAS seen it all before. Fuck knows what she got up to when
she was in the CIA. I'll bet they used her for more than courier
work. You know what? I don't really want to know. All I know is
that I fell in love with Anne Baxter, and now she has gone
forever!" Mark put his head down a little. It hurt too much to
think about it.
-- o -- o -- o --
Anne sat there for the best part of an hour before she
detected a slight movement from Elizabeth. She had taken the
time to firmly restrain Angela, even though it would be several
hours before she woke up. During that hour she had perfected
what she was going to do and what she was going to say. Her
backpack was on the floor in front of her, just in case.
If she gave Elizabeth a clean bill of health just to enable her to
pass the test, when in fact she would have failed, then
somebody else would notice and kill her anyway. She was also
sure that Heinlein would have a backup in case she chickened
out. The only way to save Elizabeth was if she was to do it
herself.
"Who are you?" A nightingale like voice asked her.
Anne looked up and saw a pair of bright blue-gray eyes studying
her intensely. The eyes checked out Anne's pistol and didn't
show a sign of fear. It was just another obstacle to overcome
before she escaped.
Anne so wanted to tell Elizabeth who she really was, but knew
the shock would be too great. "You can call me Friday. And I'm
one of the good guys," Anne discretely put her hand inside the
open backpack and flicked on the voice recorder. If anything
went wrong this would be essential evidence.
The blue-gray eyes looked at the unconscious Angela and then
at the pistol once more. "Then why the pistol?"
"Insurance," Anne replied.
"So why am I not out of here already?" the voice demanded.
Anne asked. "We have some unfinished business first. Elizabeth,
how are you? What did they do to you?"
"They tried to make me join them. They told me all sorts of lies
to convince me to abandon my family and my fiancée. They
failed." The voice was cold and matter of fact.
Interesting, she shows no sign of trauma, Anne thought. Was
this usual or a symptom of something worse? "It's ok, you're safe
now. We need to wait until help arrives."
"How'd you find me? Where am I?"
Again the dispassionate nature of Elizabeth's tone worried her.
"Doesn't matter how I found you, and you are in a farmhouse in
England."
"You don't sound British! Friday sounds more like a codename."
'Smart Kid' Anne thought. "I'm not, I'm from the US
government."
"Why are they involved?"
"Because of who you are?" Anne replied. Here it comes. How
would Elizabeth answer?
"A celebrity? Wow that's VIP treatment for you. My very own spy
to look after me!"
'Clever answer' Anne thought. Intuitive reasoning about the spy
part too. "No, I meant you being a direct copy of Dr Bexley."
Anne looked for a reaction, but didn't see any sign. Elizabeth
was playing the game very well indeed. She was holding her
cards close to her chest. It was as if she didn't trust the one sent
to rescue her. "Who's that? " Anne asked nodding towards
Angela.
"My room mate. She tricked me into thinking she was my best
friend, when all along she was plotting to subvert me. Set me up
so that when she took me down I would fall even further. She's
ruined my life! Is she dead?"
"No. I just stunned her," Anne said. Crunch question number
two she thought.
"Pity," was the icy reply.
Anne started to get worried. Kat would have drummed into
Elizabeth the sanctity of life, all life from an early age. The cold
heartless way Elizabeth answered didn't reflect that teaching
one bit. "Why 'pity.' Surely she deserves a fair trial?"
"Yeah right. She fucked up my life. Fucked up my marriage to
Alex, and arranged to have me kidnapped. Why shouldn't she
die!" the voice sounded harder still.
'Now we are getting somewhere', Anne thought. She pressed in.
"I agree with you. There's only you and me here and I won't tell
anyone. What do you want to do with her?" Anne saw a look of
fury flick across Elizabeth's face and her heart sank. Things
were not looking good for Elizabeth.
"I can't tell you what I want to do with her. That's between her
and me. Why can't you untie me?" was the reply.
"First rule of business. Trust no one. You could be anyone. An
imposter waiting for me to untie you before you strike. No, you
can stay as you are," Anne replied.
"Hello, mother," the voice said softly.
Anne was staggered. How in hell did Elizabeth work that out?
She had given no clues as to her identity at all. She knew
Elizabeth was quick at deducing information because she was
as well, but the speed of that deduction from her was scary. Had
she underestimated Elizabeth? She decided to play dumb,
"Sorry?"
"Oh come on. Let's not fool around anymore. You know who I
am and I know who you are. I think like you do, remember. But in
case age has addled that brain of yours here's how it goes. You
would never commit suicide in a fit of self pity, would you? Your
changeling abilities would be far too useful for the government
to ever let you go free, so you're working for them. You wanted
the chance to see and save the life of your long lost daughter so
you offered to come and get me. I've long suspected you were
still alive. That was the only logical conclusion from my research
into the aftermath of the fury directive incident."
Anne spotted Elizabeth's flaw in reasoning. That was good, she
needed an edge. Elizabeth was sharp, probably sharper than
she had been at her age. The only way to move forward was to
try and put her off balance "What have you done with
Elizabeth?"
"You are losing your touch, mother, aren't you?" was the slightly
mocking reply.
'Fuck she IS sharp!' Anne thought. Elizabeth hadn't even
flinched with surprise. Anne knew that something was up with
Elizabeth, that the kidnapping had taken its toll, but there wasn't
enough evidence, only a suspicion. If Elizabeth was ok, why did
she just sit there and trade cryptic answers? Anne thought it
was like two chess players seeking to out maneuver the other,
but why was Elizabeth playing the game at all?
Elizabeth saying, "Why didn't you visit me? I'm sure Matthew and Kat
would have wanted you to," interrupted her train of thought.
Anne spotted the trap. If she gave her reasons she would
confirm Elizabeth's suspicions. If she denied them then she would
fall deeper into the web of veiled meanings that Elizabeth was
weaving. The further she allowed herself to be dragged in the
less likely she was to get the information she wanted. She knew
Elizabeth was trying to muddy the waters for her, but for what
reason? The only way to win was to change the rules. She
stood up and standing in front of her concentrated. She felt her
body shift and flow around her and within a few seconds stood
in front of Elizabeth in her new form.
"Very impressive. So you do admit to being my Mom then?" the
voice sounded surprised, but also a little smug, as if she had
worked out how a magician performed a certain trick.
Anne sat down once more. It was odd to be back in the shape of
her old Elizabeth Bexley body, but she didn't have time for
feeling odd, time was running out. It was time for a different
approach. "Yes daughter, it's me. I had to come. I'm sorry I
stayed away for so long but I had no choice," Anne's tone was
soothing and all trace of confrontation had gone.
"I know. They made you stay away. Why did you try and trick
me?"
Anne decided to play on Elizabeth's paranoia and lack of trust.
During their little maneuverings Elizabeth hadn't thanked her
once for rescuing her, hadn't trusted her enough to really
demand to be untied, and had been so wary of her motives that
she had refused to be drawn into any subject. Only the slight
slip about Angela had revealed anything was wrong at all.
Even then someone who didn't know Kat's thoughts on killing
would think that was a natural reaction for someone in her
situation. It was also telling that Elizabeth had displayed no
emotion during this time. It was as though somehow she was
disconnected from the whole thing. This all meant that Elizabeth
didn't trust anyone, now it was time to play on that distrust. "You
don't know the number of times I wished I could have been
there for you but I had to stay away. I had no choice."
"We always have choices," was the guarded reply.
Anne smiled inwardly. It was working, "Not always."
"Why haven't you let me go yet? Why all the questions? Are you
testing me?"
Anne smiled. That was the breakthrough she was looking for, "I
want to see if you are worthy."
"Worthy of what?"
"Of me," Anne said. It was natural Elizabeth would compare
herself to her. A question Elizabeth would have asked herself
over and over again was 'Am I like my mother?' The question
she had just asked was designed to play on that and maybe
draw something out.
"What do you have in mind?"
Anne smiled inwardly. Gotcha! Now it was time to go to work!
"Why should we be apart? Why not join together as mother and
daughter. Just think what we could achieve together!"
A smile flickered across Elizabeth's face for the first time. "What
do you have in mind?"
Anne's plan was working. She had been giving veiled pointers to
Elizabeth, feeding her paranoia, her desire to dominate any
adversary, and her desire to know more about Anne. By playing
to these needs Anne was building Elizabeth's confidence that
she could be trusted. Now was the acid test, "I think it's time we
took back what was ours. For the last thirty years I've had to
play miss goody two shoes and it's worn very thin. On my own I
made too many mistakes. Getting the Guild involved was my
biggest. With you and me, we don't need the Guild or the Children
of Bexley. What a bunch of amateurs they are! We only need
each other."
"You're worst mistake was not killing them all when you had the
chance. You were too merciful."
Inwardly Anne cringed. She had drawn out of Elizabeth what
she had feared and suspected had happened. She was too late.
Elizabeth had been corrupted by whatever this Angela had done
to her. Could Elizabeth be turned back? If so, then she didn't
need to die. "I see that now. I still hate them, Matthew, Kat and
Cathline. They drove me away, forced me to work for the
government and not have a life of my own. I've been a fucking
prisoner for thirty years. Dr Bexley do this, go there, kill that
person, deliver this package to so and so. I'm as much a
prisoner as I was when I was in the ocean. Maybe more so. But
now you have the chance to free me. That's why I wanted to
come. Beloved daughter, you are the only person who can free
me. I'll do you a deal. You free me and I'll free you and we'll go
after those who have harmed us together."
"No deal," was the icy cold reply.
'Fuck' Anne thought. She'd blown it. Elizabeth wasn't convinced.
"I want to deal with them all. You can have them after me. I want
to deal with Matthew, Kat, John and Cathline. They've lied to
me, robbed me of my happiness with Alex and ruined any
chance of happiness I had. They deserve what I'm going to do
to them. I've worked it all out too!"
Anne's heart sank. She really was too late. But just how far had
Elizabeth gone? "Before we go into specifics I'm not called
Elizabeth. Elizabeth was the doctor who helped people. Please
call me 'Lizzy' or Mom. I dealt with my own 'Elizabeth' a long
time ago. Who are you?"
"You can call me Deianeria," Deianeria replied. She was so glad
that her mother had returned to help her. She had been uneasy
at first. Unwilling to show herself, and if anyone else had been
there to 'rescue' her she would have pretended to be Elizabeth
forever. Her mother had spoken the truth. Truly she had been
deceived and abandoned once more. Well, together they would
get their own back. She felt overjoyed. It was supposed to be
like this. This 'Lizzy' her mom had talked about had done the
same thing as she had to prissy Elizabeth a few hours ago.
Thanks to Angela she was now free of her and soon thanks to
her mother she would be free to pay back those who had ruined
her marriage to Alex. Deianeria relished the thought of bringing
her own mother into her previously private world. The thought of
sharing turned her on.
Anne asked, her voice mimicking Deianeria's cold
dispassionate tone, "What are you going to do with them? Tell me
everything. Let me know what you are planning, so I can help.
Nothing is too bad for them. Thirty years of pain and all because
of them!"
Deianeria smiled. "You'll like what I have planned for them. After
you rescue me and return me to my no doubt overjoyed
parents I'll wait a while just to let them know I'm ok. A small
amount of sedative in a celebratory drink will do just fine and
then the fun begins. I want to do this alone, but don't worry, I'll
record the entire thing! We can watch it later on, together!"
Inside her Anne felt sick. This Deianeria sounded so much like
she used to at the height of the Fury. Was this what people were
afraid of in her? "Then what happens?" she asked.
Deianeria's blue-gray eyes lit up. She could feel herself getting
aroused at the thought of what she was about to say. It's a
shame her mother didn't seem in the mood for a mother-
daughter reunion. Maybe later. "Then I take them all down to
Stephanie's cove. I've got everything all laid out for them.
Chains for Matthew and John, a nice large bed for Cathline, Kat
and me. Finally I would bring down Matthew's pistol to ensure
everybody does as they're told. Oh and a nice knife too, just
in case. I would then chain Matthew and John to the wall and
then Kat and Cathline to each other. You remember how much
Cathline wanted to be with Kat again? Well this would be her
chance. Here's how I see it going."
"Elizabeth unchain us at once," Kat will demand.
I'll reply, "No way. I'm sure Cathline here doesn't want to
be untied do you Cathline?"
"Elizabeth why are you doing this to us? What in hell do
you think you are doing?" Cathline will squirm and try,
and free herself from her chains. In doing so she'll
rub against Kat's naked body, her breasts will gently
stroke Kat's. From my vantage point above them I can
see Cathline's nipples become erect and I'll know she's
getting turned on.
Matthew is shouting at me to unchain him and John. He
tries to escape, but it doesn't work. I've done my job too
well. I'll say to him "Don't worry daddy I'll be there soon."
I'll turn my attention to Kat and Cathline "Now here's how it
goes. Cathline you've always wanted another chance
with Kat, so now I'm giving it to you."
"No fucking way!" Cathline'll swear at me, her voice full of
venom.
"Yes, way, Because if you don't then I will shoot one and
leave the other one alive. Her death will be on your
hands. If I think you aren't performing, as you should;
then the result will be the same," to emphasise the point I'll
ram the pistol down Cathline's mouth and fingered the trigger.
"Elizabeth, I thought you loved us. We love you," Kat is
starting to cry now. She knows I mean what I say after what I
just did to Cathline.
"You should have thought of that when you all decided to
hide the fact that Alex was my brother from me, shouldn't
you!" I then pulled the gun out from Cathline' mouth and she
gave a sigh of relief. I won't kill you just yet Cathline, I
think to myself.
Anne was shocked. So that was what they used to turn
Elizabeth into this monster called Deianeria. This was a new
development! She was tempted to interrupt Deianeria but decided
against it. She needed to see just how far Deianeria would go.
Again the question, was she ever this cruel?
Deianeria continued fantasizing, oblivious to what was going on
around her. It didn't matter if her mom listened in. She was part
of it now, she'd understand, and maybe she'd even join in!
Deianeria tried to feel her pussy but couldn't reach it, "Mother
rub my cunt. I'm so horny please," Deianeria pleaded.
Anne's feeling of revulsion grew. She wanted no part in this but
for Elizabeth's sake she had to be sure, "What happens then?"
she asked.
Deianeria gave Anne a seductive smile. Her mother was playing
hard to get, but that didn't matter. For now, only her fantasy
mattered.
"We're sorry. We thought it best," Kat will start to say.
"Kiss her bitch, fondle her tits, and put your finger in her
cunt. Otherwise Cathline dies!" I'll shout at Kat.
Gingerly Kat gently kisses Cathline on the lips and puts a
hand on her breast. Kat isn't trying, so I fire a shot just
above Cathline's head. She gets the message after that.
Cathline does too. A few moments later they're kissing
passionately and touching each other's pussy, tits and
ass. After a few minutes they're starting to get into it
and I feel myself getting turned on just by watching them.
I so want to join in, to rub my hands up and down Kat's
slim, lithe body and plunge my fingers into her wet pussy
but I know I can't. I think to myself that maybe I will keep
Kat alive, as my plaything and my slave. I can hear their
moans start to fill the cavern. Matthew and John are
looking on with disgust, but their erect cocks tell me they
are getting turned on too. Dear Mother men are so easy
to read aren't they?
By now Kat and Cathline have fully embraced each other
and are kissing and caressing as much as their chains
will allow. They beg me to loosen them so they can go
further but I know what they are planning. I hear Kat
moan like she does when Matthew is fucking her and that
pleases me. She's not holding back. Cathline is moaning
too, actually it's more like a gasp. I've never heard
Cathline being fucked before, so I can't tell if she's acting
or not. But as I stand and watch Kat put two fingers inside
her cunt and move them in and out I know she's not
faking either. Their gasps come quicker and quicker and I
know they are reaching climax together. I feel so wet in
my pussy that I just have to get some relief. I take off my
skirt pants and knickers, and run my fingers around my
clitoris. I then take off my blouse and bra so I am now
naked and feeling very horny. My moan's mixing in with
those of Cathline and Kat drive me wild. Pleasure is
rushing up and down my body, fanning out from my
pussy and onto my breasts. Unable to hold myself back I
drop the gun away from them and jump onto the bed
sitting firmly on both of them, so that they can't get me. I
stroke their backs and their smooth asses. Fuck Cathline
has a good body. I can see why you designed it like it
was, mother."
Anne felt sick inside. Were there no depths to Deianeria's
depravity? Had she ever done anything like this? Yes she had!
She had done it with Cathline and a partially female John, in her
pool. She had let John fuck her whilst licking Cathline out. So
much of what Deianeria was thinking about doing she had
thought as well! Deianeria continued fantasizing and Anne
listened, desperate to see any kind of ray of light for Elizabeth.
However, she knew that she was clutching at straws, whatever
was going to happen to Elizabeth, she was too late to prevent it.
"I can feel our body's start to quiver as we build up to
climax. I can feel a finger touching my Clitoris, gently
caressing the nub of flesh around my pussy. I look to see
whose hand it is, it's Kat's, and boy, does she know what
she's doing! We are all gasping with pleasure now, faster
and faster and faster, until with a scream of pleasure I
come. I get off the bed, trying to ignore the moans from
the bed begging me to come back. They get back to each
other and I see the ripples of pleasure go thru their
bodies as they come, Kat first and then Cathline. They
lay back, exhausted from their love making and look at
me expectantly.
"Now what should we do with you two?" I say turning to
Matthew and John. I can see their erect cocks waiting
expectantly. In spite of their protests they were turned on
at the sight of Kat, Cathline and me having sex. My pussy is
still moist and wet and it demands cock.
"No Elizabeth please let me go," John pleads. John was
the first to speak, so he is the first. He is unable to move
from his spread-eagled position, so I move seductively in
towards him. I feel his large firm cock, and stroke its
length. It's a good size, firm and stiff. I open my legs,
stand on tip toes, and thrust it inside me. I can feel it's
warmth inside me, and I clench my pussy muscles,
clamping onto its girth. I then move, thrusting my hips into
his again and again I feel it slip in and out of me. I start to
moan once more. John is trying to pull it out of me, but he
can't move. I rub my breasts against his chest and into
his face, and feeling the rough hair on his chest rub
against my firm bosom makes me feel even sexier. I
speed up my rhythm until John can't help but come inside
me. I can feel his warm wet cum in me and feel it start to
seep out. But you know mother, I'm saving the best till
last.
Unseen by Deianeria Anne flipped the safety off her pistol and
then listened to Deianeria continue.
Matthew's cock has gone flaccid. That's no fun at all! I
bend down and using my mouth and tongue I start to
caress it. In spite of Matthew protesting his body's instinct
kicks in and his cock starts to rise. I give him a seductive
smile and put his large dick in my mouth. I grip it with my
mouth and move my mouth backwards and forwards,
until I feel Matthew's hard erection in my mouth. Before
he can get it to react I push myself into Matthew. Like
John he tries and resists, but I've got him chained too
tight. His dick is just like Johns hard, warm and firm. I'm
so moist and turned on now it slips right in me. Matthew
is hurling abuse at me, and trying to push himself off me,
but he can't do anything to prevent me ramming his cock
into me and gently rocking back and forth. So this is what
it felt like to be screwed by Matthew. I'd wondered what
you felt ,and now I know. It feels so good. His cock is
brushing up against my clit and I can't help but moan out
loud. Kat and Cathline are protesting, but all they do is
make me more turned on. I'm now pushing in and out so
fast I can hardly keep him in me. I am so near to coming
once more it hurts. I thrust him into me again and again
until I feel his cock start to throb inside me. I pull myself
out of him and feeling my warm moist pussy I finish
myself off.
Matthew is in tears. I know I've broken his heart and that
alone pleases me. "My mother made you a woman years
ago, and you know what they say, like mother like
daughter. I hope you enjoyed that fuck Matthew, because
it was your last as a man! You're not going to be a full
woman, just my sissy slave who I will dress up in pretty
dresses, and I think your hair could do with some
restyling. But first this.
I walk over to the knife, pick it up, and pressing Matthew
against the wall I move the knife over top of his balls and
cock. Holding them with one hand I slit around his left testicle --
his screams of pain is like music to me as I cut round it and pull
it away. I stop the bleeding quickly and then, gently run the
scalpel down his bleeding cock, creating bloody slits in it as
I go. Matthew is screaming and screaming in agony and this turns
me on even more.
Finally when his cock and ball is in bloody tatters I push the
knife down. Matthew screams in pain as I rip his cock and remaining
ball off and show it in front of his face. Kat is screaming at me to
stop but it's now no good. I quickly patch up the wound
leaving him with a nice girlie slit. It's crude but it will do
until I can do a proper job on him. Matthew has passed
out in shock. He will have another shock when he wakes
up. I've brought some corsets in especially for him. Soon
he'll have his hourglass figure back, just as he used to.
He should be used to wearing dresses by now; maybe I'll
make him my sissy maid. I like the sound of that.
I turn my attention to John. He struggles to resist but I'm
too strong for him when he's all tied up. I say to him,
"Don't worry brother dear. Matthew lived as a girl for
years, he'll show you how. I've got a nice set of dresses,
skirts, bras(yes, you'll need them too) and blouses you
can share with Matthew. We'll have so much fun dressing
up together and sharing clothes, just like sisters! Actually
it should be Mandy now. John is still screaming as I sever
his penis and scrotum, and again show him it. I work
quickly to stem the blood flow and soon he has a nice
crude pussy the same as Mandy's. He blacks out under
the shock and pain but that's ok. I'll give him the first of
his hormone injections while he's out. I've always wanted
a sister and now I've got one. Maybe he'll learn how to
please a man in some Asian brothel. Yes mother, that's
what I'll do to him!
Kat and Cathline are screaming abuse at me, begging
me to stop but it's too late. There are now two extra girls
in the Stephens family. I can't wait until Mandy and
John's, sorry, Janet's waist starts to narrow and their hips
start to grow. They'll look so cute together, and as for
when Janet's titties start to grow think of the fun we'll
have trying out bra's together!
That's where you come in dear mother. You can choose
which of them you want for yourself. I want Kat and
Janet. I think you'll like how Mandy is going to turn out.
I've got it all planned. What about Cathline, I hear you
say? I'm sorry but you can't have her. She's the one who
didn't tell me about Alex, so she has to die. I know you
wanted her but Mandy should be enough for you. I'm
going to take the still bloody knife, and ram it up her cunt
and slit upwards with all my strength. She'll scream as
the knife digs into her and as I run it up her perfect body
she'll pass out from the blood loss. I'll keep Kat chained
to her and make her watch as Cathline slowly bleeds to
death in front of her."
Anne had heard enough. Nothing she could say would be able
to stop Deianeria from carrying out what she had just described.
Her daughter, the real Elizabeth was gone, snuffed out by
Deianeria. The extent of Deianeria's revenge had shocked her,
and yet it was nothing she hadn't thought of. Or even done
herself. Had she really been that bad? Yes she had, she had
taken the cult leader apart organ by organ while he was still
alive and with no anesthetic. She knew she had done wrong in
the past, but hearing Deianeria speak it with such glee and
sexual excitement really bought it home. No wonder Mark ran
away from her. She checked her watch, it was now time to put
her alternative plan into action. She knew that in the days,
weeks and maybe months to come this moment would come
back to haunt her but Deianeria had left her with no choice.
Deianeria had killed Elizabeth not her and now it was time to put
her desperate plan into action.
"Come now daughter let's go. I can't wait to fuck Mandy," Anne
crooned. She moved over to where Deianeria was seated and
undid the straps.
"Thank you mother. I know you'll enjoy enslaving Mandy."
Deianeria tried to stand up but hours being
strapped to a chair had made her legs weak. Anne helped her to
her feet and after a few moments Deianeria was able to stand
up properly.
"After you daughter," Anne gestured and indicated for Deianeria
to leave first.
Deianeria gave a sweet smile "Why thank you mother and
turned to leave.
Anne took a deep breath "Daughter?"
Deianeria turned to face Anne.
"Goodbye my love," Anne said softly, her voice full of regret and
compassion. She then took precise aim; she would only get one
chance, and fired the pistol into Deianeria's chest. The silenced
pistol made a 'phht' sound and for a few seconds Anne thought
she had missed as Deianeria stood looking down at her chest in
shock. She then looked up her eyes wide with surprise and
betrayal, Before she could do anything else she collapsed to the
floor blood seeping out of a small wound in her chest.
Anne ran to her backpack and took out her sat-phone. She
made a hurried call to the emergency services before walking
over to Angela. She aimed at an oblique angle at Angela's
shoulder and fired from a few meters away. Angela's body
twitched with the impact but she didn't wake from her inert state.
Anne checked the bullet wound and pulled the paralyzing dart
from Angela's body. After untying Angela, she placed the gun in
Angela's other hand. When the police arrived they would think
there had been a struggle, and Angela had shot Elizabeth as
she tried to escape. Anne had thought about killing Angela, but
she had seen too much death to last a lifetime. For once she
would be merciful and let the authorities deal with Angela.
She turned to look at Elizabeth's body on the floor, the flow of
blood had stopped and all color was draining out of the body.
She checked the pulse but could find none. A wave of deep
sorrow crashed over her as she realized what she had done.
She walked over to Elizabeth's body, cradled it in her arms and
wept and wept over her fallen daughter.
-- o -- o -- o --
Alex was waiting by the phone in his Cambridge hotel room. Kat
was only six hours away and Cathline would be here in the
morning. There had been no news from the kidnappers at all,
which had surprised the police as usually demands are made as
soon as the kidnap is made known. He had tried to remain
strong for Kat, but inside he was desperately worried. He and
Elizabeth had grown so close over the months they had been
together. How cruel would it be for their love to be denied?
Frustration was starting to creep in, he felt powerless and at the
mercy of the fates. There was nothing he could do except wait
and pray. He'd tried watching TV but every cop show or drama
only served to rub salt in the wounds. The comedies he couldn't
laugh at and even the Kweepa and Rooney movie on pay per
view seemed puerile and pointless. Frustrated and bored he lay
back on the bed and thought back to the fun times he and
Elizabeth had had. The first date was one of the most
memorable. It was as near perfection as he could have
imagined. It was, however, the day he had asked her to marry
him, which stuck in his mind. It hadn't been a grandiose affair.
He had proposed to her over a simple meal at his house; he
wanted the moment to be a special one and not contaminated
with fancy meals or venues. She had taken one look at the ring,
a simple diamond and gold affair, and said "You really expect me
to marry you after the lifetime of grief you caused me?"
His heart had sunk at the sound of this. He had blown it. A laugh
from the other side of the table made him look up. Elizabeth had
placed the ring on her finger and was inspecting how it looked
on her hand. She smiled. "Alex, Yes I will marry you," and they
had embraced, both wishing that moment would never end.
There was a sharp knock on the door and Alex swung his legs
out of the bed and answered it. Inspector Jones stood there and
was accompanied by another police officer. "Hi Inspector. Any
news?"
"Can I come in?" Inspector Jones said. He pushed his glasses
back onto his nose as if trying to avoid saying something.
"Sure. What's going on?
Inspector Jones turned to his fellow officer and said "Bob put the
kettle on for us please. Mr Richards, please take a seat."
Alex's desire for news turned to apprehension. Inspector Jones
didn't look at all happy to be there. It was as if he had to perform
the worst job in the world but Alex sat down as instructed.
"Inspector what in hell has happened?" Alex demanded.
"Elizabeth's been found. She was in a farm house in Yorkshire,"
inspector Jones started to say.
"That's great! Is she ok?" Alex interrupted.
"I'm afraid not. She was shot in the chest at close range during a
struggle with her kidnapper. It looks as though she was shot
trying to escape. We have the kidnapper in custody."
"How bad is it?" Alex asked. He hardly dare ask but he had to
find out.
"Very nearly as bad as it can be. She's in St Lukes hospital
Huddersfield. She's in a critical condition with severe damage to
her heart, lungs and she was bleeding internally. At the moment
the only thing that's keeping her technically alive are the
machines. That's all I know. We have a car waiting for you if
you'd like to go there. It'll take a few hours but the doctors don't
expect much change in her condition. I'm sorry Alex, I really
am."
Alex sat there stunned. The woman he loved, the woman he
was going to marry and his 'soul mate,' was virtually dead.
Elizabeth's life hung by the slenderest of threads and he was
powerless to do anything about it. "Do Matthew and Kat
know?" Alex managed to say.
"We called them before we came here. Matthew's on his way
here now but it will be a number of hours before he gets there. I
would suggest you try and get some sleep in the car."
Alex nodded and took the cup of strong sweet tea that the other
police officer had just made him. He took a sip and swallowed
the warm, sweet liquid. He knew the real motive behind the
drink; they were treating him for shock. Putting down the cup of
tea on a nearby table he collected a few things and put them in
his bag. He wouldn't bother to check out. He'd settle the bill by
PDA later on. He was escorted outside and got into the white
and yellow striped Rover-Proton police car. He suddenly felt
very tired and was soon fast asleep.
-- o -- o -- o --
From her vantage point above the farm house Anne had
watched the ambulance take Elizabeth's body away, closely
followed by a still unconscious Angela. Police had stormed into
the house and soon made it difficult for Anne to stay around and
watch. She had sprinted the kilometer back to her car and had
deduced they would take Elizabeth to the best and closest ER
possible. It took her about twenty minutes to drive into
Huddersfield and she tried a couple of hospitals there before
locating St Lukes.
She shifted form into a five foot five brunette and quickly located
the laundry room. No matter where she went all hospitals were
the same. From Adelaide General where she'd lain comatose
and near to death to her fathers hospital the layout, atmosphere
and attitude was all the same. She quickly found a clean nurse's
uniform, and checking that the coast was clear she put it on. She would
ask Heinlein for a valid ID later on but for now the uniform would
do, as in her experience most people didn't even check for a
badge. In an overworked hospital who'd notice an extra nurse?
She quickly located the intensive care room and slipped inside.
Looking at the array of equipment, she was impressed. She had
expected to find older less effective hardware, but this looked
brand new. She checked each bed in turn and saw Elizabeth
lying in one, in a side room. Her skin had a pallor of death and
the monitors showed that she was barely alive. Anne touched a
few of the displays in order to get more information. Given the
circumstances, Elizabeth's condition was as good as she could
have hoped for. The monitors showed that her heart had ceased
working on it's own an hour ago and was now being artificially
stimulated by the machines. Both her lungs had failed and she
was now on artificial ventilation. Brain activity was almost zero, it
was borderline as to whether Elizabeth was technically alive or
not. When they got there Matthew and Kat would need to decide
whether to turn the machines off or not. It was not a decision
she would want to make herself, but she had done so when
she had shot her. She now wished there had been any other
way, but the way she had chosen had been the only one left
open to her.
Anne walked over to a series of X-rays and scans pinned to the
wall over Elizabeth's bed. To her relief it looked as though she
had hit exactly where she had intended. Using her changeling
organ she could manufacture and inject Elizabeth with a serum
that would gradually repair the wounds, as she had done years
ago with Detective Tina Cox but Elizabeth probably wasn't
strong enough to cope with even the smallest dose. For the
moment, it was now down to Elizabeth to cling onto the tiny
fragment of life that remained in her.
"Can I help you?" A deep voice sounded from behind her.
Anne whirled round to see a tall man with glasses and thinning
hair. "Sorry?"
"Can I help you? I don't recognize you. What are you doing
here?" The doctor asked.
Anne used the response she had prepared for such
eventualities, "You were a few nurses short for the night shift so
they asked me to transfer from the Royal for tonight. She's a
very ill young lady isn't she?" Anne said, nodding towards the
inert Elizabeth.
The doctor gave Anne a suspicious look "She wouldn't be here if
she wasn't!"
Anne decided to ignore the barbed comment, "I've seen the
readouts. How much can she support herself? Is it just the
machines?"
The doctor nodded sadly. "Apart from the barest flicker of brain
activity it's the machines. She's in a deep coma and in my
opinion is likely to remain that way."
Anne wasn't so sure about this doctor's opinion. "I'm surprised
the gunshot wasn't fatal."
"It effectively was. It was a hell of a shot though. It went into the
chest cavity splintering a rib. The bullet then passed thru her left
lung puncturing it before coming to a stop just before her spinal
cord. A centimeter further on and she would be paralyzed, not
that it matters much now."
Anne knew the answer before she asked but she needed to
gain the doctor's confidence, "So how come there's so much
internal damage?"
"The rib shattered, sending bone fragments into her other lung,
superior Vena Cava and supraventricula crest. We've managed
to patch her up by microsurgery but there was too much
damage to do anything else. It's down to her parents now. It's
their call."
Anne nodded "Thanks Doctor. What do you want me to do?"
"There's a patient in the second IC ward, change the biofilter for
us."
"OK," Anne replied. Although things had gone as well as she
could have hoped for, for Elizabeth's sake she wished she
knew Kat better.. She was tempted to come back when they arrived
but she needed to report back to Heinlein. She would stick around for
a few days to make sure things were progressing as she wanted them to.
Besides, she needed to pay a visit to Angela.
-- o -- o -- o --
A few hours later Kat came running into the intensive care ward.
Alex had fallen asleep next to Elizabeth, his hand was still
holding tightly onto hers. The array of tubes and machinery
around Elizabeth scared Kat but it was Elizabeth's ashen gray
appearance that caused her the most concern.
"Mrs Stephens," a voice said from behind her.
Kat turned around, her eyes streaked with tears. "Yes, doctor."
"Please come with me," the doctor replied.
"What about Alex and Elizabeth? I can't leave them," Kat
pleaded.
"There's nothing you can do for her and he needs his sleep.
He's been here for hours talking and holding her hand. Please,
Miss Stephens, follow me."
Kat was led into a side room, and sat down on one of the plastic
chairs in the room.
"What have you been told?" the doctor asked.
Kat, still numb with shock and worry answered as best she
could "That Elizabeth is extremely ill and the it's the machines
that are keeping her alive."
The doctor nodded. He hated this part of his job most off all.
Especially when they were young and had a whole life in front of
them, "It's not the time just yet, but we need to think long term
about Elizabeth, what's best for her. There comes a point, which
we are not yet at, when it becomes pointless to prolong her life
any longer. We can keep her heart beating, her lungs working
and the rest of her body functioning indefinitely but there is very,
very little brain activity. It's being fed oxygen and as far as we
can tell there is no physical damage but we are facing the very
real probability that she may never recover from her coma.
Sometimes the body just shuts everything down and forgets to
come back again. From where I'm standing and based on years
of experience, it looks to me as she will never come back to us.
The injuries and blood loss are just far too great."
Kat tried her best not to cry. Elizabeth would tell her not to be so
silly; to be strong for her, Matthew and Alex. But Kat couldn't
help but feel deep despair. Wiping away a tear from her eye she
asked "What are you saying doctor?"
I'm saying that you need to start thinking about how long you
are prepared to wait before we switch everything off and let
Elizabeth die peacefully and without pain. It's a choice we need
to make together based on her condition. All I'm asking is that
you and your husband give it some thought."
"I can tell you right now. I forbid you to switch off those
machines! Not now, not ever!" Kat snapped.
The doctor nodded. "Ok, but every day she lies there she is
using resources that other people desperately need. She's too ill
to move or be unplugged. Sometimes it's better just to let go."
The doctor put a comforting hand on Kat's.
Kat looked up and wished that Matthew were here.
-- o -- o -- o --
Anne had called Heinlein in her car and told him what had
happened. She was now in a bitter argument with him over her
failing to kill Elizabeth outright.
"The fact remains that you were ordered to kill her if she failed
the test. I've got another team on standby. They'll do the job you
failed to do. In all our years of working together you never
fucked up this badly. You did this on purpose!" Heinlein shouted
down the phone.
"Too right I did it on purpose! I needed to give Kat, Matthew and
the rest of the family time to say goodbye. I never got the
chance with my parents and I'm dammed if I'm going to put
them through what I went thru. You've seen the medical reports.
She's not going to wake up, and in a month's time, after they've
said their good-byes, they'll switch off the machines and let her
die in peace with her family all around her. Isn't that so much
better than leaving a dead body in an old farmhouse with a
bullet thru the skull?"
There was a pause as if Heinlein was considering all the
options. Anne knew he was consulting the medical report in
front of him. "Ok, I'll call them off."
"When can I expect my hospital ID?" Anne asked
"You'll get it tomorrow morning. Dr Anne Williams, just
transferred from Addenbrooke's this week right?"
"Yep."
"One more thing," Heinlein demanded.
Anne was getting well and truly pissed off with being ordered
around. Especially when those orders involved her shooting her
own daughter, "What!" she said sarcastically.
"What the fuck did you do to the cult leader? It took my clear up
team three hours to sort the mess out. Consider yourself warned
on that one. Also, if you pull a stunt like you did with that gang a
few days ago I won't be able to bail you out. It took a hell of a
lot to persuade the police to drop the case. As of now you kill
anyone again and I won't be there to get you off."
"I'm not planning to, unless it's in self defense," Anne snapped.
"Screw self defense! There are other ways apart from
decapitation, dismembering and disemboweling!" Heinlein
snapped. The police had demanded to know what creature had
killed those gang members, and he had had to use all of his
persuasiveness to get them to drop the case.
"That's not what you said when you made me assassinate
Ambassador Putin is it? What was it? Use whatever force you
must," Anne snapped back. She had hated assassination
missions.
"Just don't do it again," Heinlein said as firmly as he could.
"Fine! Oh, and Heinlein?" Anne said.
"Don't call me a bastard yet again," Heinlein replied. "That
joke's wearing a little thin."
"I'm not. I'm just going to say that if you ever call me again, if
you send in your goons to kill Elizabeth off before Kat and
Matthew allow it, I'll come after you. You know there's nothing
that can stop me if I put my mind to it. If I do have to come and
get you then what I did to the Bexley cult leader will be like the
Disney matinee version. Capiche?" Anne's voice was a deathly
whisper.
"Don't you threaten me, freak!" was Heinlein's agitated reply.
"It's not a threat, it's an absolute certainty. Goodbye!" Anne
disconnected the call. She would drive to a hotel and book
herself in. She needed to stay close by for a while.
She sat back in the car seat and allowed herself to cry. Why
hadn't she thought that Elizabeth would be in danger earlier?
Why hadn't she dealt with the Bexley cult earlier? Did she have
any choice but to shoot Elizabeth? A thousand questions
bombarded her. What if she'd met Elizabeth sooner? What if
she had let Deianeria live? What if she had killed Angela?
Would Mark want her back? Did she even want to go back to
him? These and many more questions flooded her mind and threatened
to overcome her with guilt. She found tears helped relieve the
pressure a little. She had made the choices she had made, and
that was the end of it. There was nothing she could do to
change things now. All she could do now was watch and wait.
-- o -- o -- o --
Kat awoke in a hotel room not remembering how she got there.
The clock on the table said 8:16am. She had slept almost ten
hours! Matthew would be here in an hour or so. Cathline too.
She needed them more now than ever before. In some ways it
was easier when they were in danger. She knew they could help
themselves. But this? She felt so helpless and shocked. How
could Elizabeth be effectively dead? They had escaped from the
Guild civil war, survived an explosion of a laboratory, being shot,
having cancer and numerous other hardships, and now this. It
didn't seem fair. Elizabeth had had her whole life in front of her.
They had been planning the wedding only a few days before
and now she would be thinking about funeral arrangements.
Kat had to admit the doctor had a point. They couldn't keep
Elizabeth on the machines forever. Sooner or later they would
have to switch them off. She felt tears well up in her eyes again.
Elizabeth was so young. Where had the time gone? It only
seemed like yesterday that Elizabeth too her first steps, tottering
along the furniture before launching out into the middle of the
room. She remembered Matthew playing chase with her, of
them flying a kite for the first time. More tears flowed as she
remembered Elizabeth at a precocious five telling the world she
knew everything there was to know. Her teaching Elizabeth to
swim in the pool, of making clay bugs on the table. The pride
she had felt as a parent when Elizabeth had aced her exams
allowing her to enter medical school, and more recently the
sheer rightness of her engagement to Alex. That relationship so
much reminded her of hers and Matthews, and now it had been
cut tragically short.
Alex walked into her room, carrying a tray with a pot of coffee and
some croissants on it. "Hi Kat. I thought you might like some
breakfast."
Seeing Alex brought fresh tears to her face. He looked older,
more worn out than she had ever seen him. His normal fun
loving self had gone, replaced by this husk of a man. "Thank
you Alex." She said softly, taking the tray from him.
"I booked us into a hotel. You'd fallen asleep beside her when I
awoke. I figured we needed our rest so I took us back here.
Hope you don't mind," Alex said.
Kat put the tray to one side and gave Alex a deep embrace "Oh
Alex, I'm so sorry," she cried.
Alex returned the hug and sat down, fresh tears in his eyes.
"She looked so ill when I came. She looked dead already. I
spent hours just holding her hands and talking to her. I prayed
to any god that would listen that they would take me instead. I
tried to make her better by force of will. I would take her place in
a moment if I thought I could."
Kat gave a tearful nod. "I would too."
"But God or whoever didn't listen. They say she's already dead.
How can that be, Kat? I love her. People say that love is the
strongest force in the world, but that's not true is it? If it were, I
could love her back to life, and then we could get on with our lives. I
just wish it were me there, that's all."
Kat gave a sob. She had wished the same thing again and
again. She wanted to say something, but couldn't find the right
words. She held Alex's hand and embraced him once more.
"Y'know Kat. They said they were going to ask you about
keeping her alive, well, keeping the machines running that is. I
need to know what you told them. Please Kat, I love her so
much," Alex said tearfully.
"I told them to go to hell. But if the time comes, we'll make the
decision together, you, Matthew and me. In the meantime, we
spend every hour we can being with her, being there for her,
and telling her how much we want her back." Kat tried to sound
hopeful even if she didn't feel it herself.
"Come on, your coffee's getting cold. Let's watch some TV," Alex
said handing Kat the tray.
"TV on," Kat said picking up a warm croissant and handing it to
Alex.
The picture on the wall faded from view and was replaced by a
TV picture.
"DNA tests and brain scans have confirmed allegations that
Elizabeth Stephens is not the real daughter of Matthew and
Jane Stephens but is a direct clone of the late Dr Elizabeth
Bexley. This dramatic new evidence came to light yesterday
hours before Elizabeth Stephens was found gravely injured in a
Yorkshire farmhouse. Her situation is described as beyond
critical."
"TV OFF!" Kat screamed.
Alex was staring at Kat in hurt and pain. He put his croissant on
the bed and stormed out. Kat held her head in her hands and
sobbed. Surely things couldn't get any worse.
-- o -- o -- o --
As Mathew walked from the taxi to the hotel reporters mobbed
him. They huddled around him, trying to get that sound bite
quote from him that would make the evening news. Questions
were thrust at him from all directions
"What do you say about the new evidence that's come to light
regarding your daughter?"
"What is Elizabeth's condition? Is she still alive?"
"Why didn't you tell the world this before?"
"What about the previous evidence indicating the opposite. Who
fabricated that?"
"If Elizabeth recovers what does this mean for her and her
fiancée? Does this mean she IS Dr Bexley or just shares her
DNA?"
"Did you know the kidnapper? We understand she was
Elizabeth's room mate -- can you confirm this?"
Matthew was about to answer 'No comment' but anger overtook
him. "Look why don't you all just fuck off! My daughter is
essentially dead, only the machines are keeping her alive, and
all you wonder about is something as pointless as this. I've been
on a fourteen hour flight, and I need to see my family, so fuck
off," Matthew swore and stormed inside.
-- o -- o -- o --
Matthew put his finger on the biometric fingerprint reader on the
hotel room door and opened the door. Kat was lying on the
sofa gently crying. She heard him walk in and got up. On seeing
Matthew she ran towards him and gave him a comforting
embrace. "I'm so glad you're here," she cried.
"Me too. How is she? Have you heard? Somebody's leaked out
all about Elizabeth. The press was swarming all over me
outside. Where's Alex?"
"Elizabeth is the same as she was. I switched on the TV when
Alex was here. We heard then. He glared at me and then
stormed out. I've not seen him since," Kat said sadly.
"That's all we need. We'll leave Alex to Cathline. We have
enough troubles of our own. She called me from her car. She'll
be here in an hour or so."
Kat snuggled up to Matthew "Last night was one of the worst of
my life. The doctor wanted us to think about switching the
machines off. They'll soon need the resources and space for
people they can save."
Tears formed in Matthew's eyes and he put his head on Kat's
shoulder. "Meaning, there's no hope for her."
Kat snuggled in closer "There's always hope Matthew, there has
to be."
-- o -- o -- o --
Anne pinned her new ID badge on her shirt and walked back
into the hospital. She was wearing her new body, that of Dr
Anne Williams, a divorced forty five year old with mousy brown
hair and a normal looking but educated face. She was tempted
to waltz in as the stunning new doctor, but she wanted to keep a
low profile. Consulting the hospital layout on the wall she quickly
found the secure unit where she knew Angela was about to
moved from. It took her a few minutes to walk there along the
long corridors, and eventually she turned into a side corridor and
straight into two police officers. "Can we help you doctor?" they
demanded.
In her best timid but dutiful voice Anne said, "I'm here to see
Miss Holden. She due to go into custody later on today and I
need to check if she is ok to travel."
"Can I see your ID Doctor?" One of them asked.
"Sure," Anne said and held it out in front of her.
"Mind if we check it?"
"Fine," Anne hoped Heinlein's people had done their job
properly.
A policeman scanned in the chip on the ID card with his PDA
and in a few seconds he said, "Go on, You're cleared."
"Thanks, Officer," Anne smiled sweetly and went inside the
room.
Angela was awake and reading 'Hello' magazine as Anne
walked in. Thru her hospital nightgown Angela saw that her
shoulder was bandaged tightly. 'Should I have hit your head
instead?' she thought.
"Hello doctor," Angela said sweetly.
'It's hard to believe this is the woman, no, not a woman, the
girl that did this to my Elizabeth' Anne thought. "How are you
today?" Anne asked.
"I'm ok, but they think I shot Elizabeth, can you believe it? I'm
her best friend! They kidnapped me too. It wasn't me! It was this
vicious red headed woman. She shot me, and then shot
Elizabeth. I gave the police a description of her."
Anne walked slowly towards the door and put a chair under the
door handle. She then turned to a puzzled looking Angela and
said, "Did she look like this?"
Anne felt her body morph into her 'Friday' guise and a few
seconds later stood in front of a terrified Angela.
Angela's scream had died in her throat. It was the same woman
as had paralyzed her last night! Furthermore this doctor had
changed into her right in front of her eyes. But a full body
change wasn't possible. All her life she had been told it hadn't
happened, that DNA modification wasn't possible and therefore
the events of the Fury were part of a ploy to destroy Dr Bexley.
"Who... What..." She stammered.
Anne sat down on Angela's bed. "I think you know who I am. I
can only be one person can't I? Why'd you do it?"
"Beloved Mother," Anne whispered in awe. Surely Dr Bexley
was dead. Every shred of evidence she had ever been shown
said that she had committed suicide. If Dr Bexley were still alive
then that changed everything. Why did she wait so long before
revealing herself? So many questions formed in her mind.
"I never wanted to be turned into a goddess. Why did you
kidnap Elizabeth and force her to become like me at the height
of my madness? You made her into a monster!" Anne was
trying to restrain her anger.
"She wasn't a monster. She was you! We have liberated her
mind from its shackles. Released her potential," Angela said as
though repeating some mantra.
Anne took out the voice recorder from her coat pocket, and
placed in on a tray in front of Angela. She pressed the play
button and played her interview with Elizabeth the night before
to Angela.
Angela's eyes widened with horror as seemingly Elizabeth
explained the brutal fucking, murder and mutilation of her
family. "It's a lie. You recorded it!" she sobbed.
"It's no lie. Do you know who shot her? I had to shoot my own
flesh and blood, and you made me do it," Anne's voice was a
deathly whisper.
"How did we know she would turn out like this? She wouldn't
come to us on her own. We needed to do something or else her
gifts would be lost to the world," Angela said, trying to ignore the
fact that it was her idol and her god sitting in front of her.
"Then that was her choice and you should have respected it!
When you sit in your prison cell and rot for the next twenty years
I want you to remember that you destroyed the life of my only
child. I'll never forget or forgive that as long as I live!" Anne
snapped.
Angela stared at Anne, who thought she had betrayed the core of
who she was and what she stood for. "You're not supposed to
be like this! I love you, I love what you did, and what you stand
for," Angela said, still deeply shocked by the venom of Anne's
attack.
Anne continued. She wanted to take Angela down. Not kill her,
but destroy this cult once and for all. "I've always been like this.
As for what I did, I'm not proud of that at all. Yes, I saw your
wrong and completely misleading propaganda about me, but I
ignored it. It was amusing to see you people come up with even
more improbable theories to explain what had gone on. The
worrying thing was people believed you! Sure, it was nice for the
ego to be treated as some kind of guru. However, it misled a
whole load of people. I haven't got any more answers than
anyone else. Seeing you people do this to me made me sad
and a little angry. You were defaming some of the most
wonderful people I have ever known, and in case you're
wondering who they are, they are called Matthew, Kat and
Cathline. That's right. I feel honored and humbled that they
forgave me and gave me a second chance. Not many people
would. Are they the kind of people who would commit fraud and
murder? I didn't think so."
"But you did so much good. You stopped a war, saved people's
lives," Angela's previously haughty look had gone, and had
been replaced by a look of hurt and pain.
"I also killed people. Everything Cathline wrote about me was
true. I stopped a war because I had to, not because of some
divine guidance. Actually, it took a whole load of us to do it. Kat
deserves a lot of the credit and quite rightly she gets it;
everyone involved does. None of what you gave me sole credit
for I did alone. Curing Detective Cox, I had a whole team work
on that for me. All I did was provide the plan."
Angela shook her head in disbelief, "No you're lying."
Anne gave Angela a vicious stare, "No I'm not! I've spent years
trying to exorcise the ghosts of my past and everywhere I went
you people were not only dragging them back up again but
getting them wrong. Still live and let live, or so I thought; that
was, until you took my daughter hostage. What you did to her I
can never forgive. I vented all my initial fury on your cult leader,
but when you come out from prison watch out! If you try to
revive your evil cult then I will come for you. I will come for you
all!" Anne's voice had dropped to a deathly hiss. She had
suppressed the anger she had felt before, but this bitch in the
hospital bed needed to be so scared and put in her place that
she would regret her decisions for the rest of her life. Still in the
same venomous tone of voice Anne said, "I'll say it again, just in
case you missed it. You destroyed the life of my only child,
someone who I had loved from the moment she was conceived.
It was my love for her that kept me away, and my love for her
that made me return to her when she needed me most. Yes, I
shot her; I had to because otherwise that monster would have
been loosed to the world. I may have pulled the trigger, but you
have her blood on your hands. I want you to remember how
much I hate you, how much I wish I had dissected you alive, just
like I did the cult leader."
Angela gave a gasp of horror. Her father was dead! Killed by the
woman she had adored.
Anne continued, "But I spared you. I've had enough of death
and killing, and the thought of you rotting in a prison cell thinking
on what you did to me is punishment enough. I hope it eats
away at you day by day, minute by minute, until you feel so
much grief that every day you struggle to find a reason to live. In
my mind that's far worse than a simple bullet in the head and far
more than you deserve."
Anne was about to launch another scathing attack, but suddenly
noticed Angela reach inside her mouth and suddenly started to
convulse. Her mouth was foaming and she was making gagging
noises. Anne rushed over to her as various alarms went off
around her. A few seconds later Angela had stopped breathing.
Anne quickly changed back into Dr Anne William's body, stuffed
the voice recorder back in her pocket and whipped away the
chair from the door just in time before a full crash team burst in.
"I think she killed herself. Looks like a cyanide compound. There
was nothing I could do," Anne said breathlessly.
"What happened?"
"I was taking her new readings and just chatting. She then tells
me she doesn't want to go to prison and then she reached into
her mouth and suddenly convulsed there was nothing I could
do. She was dead in seconds," Anne said sorrowfully. She
hadn't meant to drive Angela to suicide with that last comment,
but obviously being hated and despised by someone you had
thought of as divine, added to the fear and humiliation of going
to prison was too much for her. Anne knew the hospital board
would interview her over this incident but she knew she could
handle it. She felt sorry for Angela, believing that the woman
who was Dr Elizabeth Bexley was some kind of prophet and
source of all wisdom. Anne didn't feel like that at all. She
felt as though death, misery, and tragedy followed her wherever she
went. Mark was right to walk away from her. She was right in
her suicide note written years ago. She truly was death
incarnate and Mark was better off well away from her.
-- o -- o -- o --
Kat, Matthew, and a newly arrived Cathline hoped they would
find Alex at the hospital, but when they arrived at the IC ward he
was nowhere to be found. The hospital staff had done a fine job
of keeping the press away, so they entered the hospital
unmolested.
Kat had hoped that Elizabeth's condition would improve
overnight, but a briefing from the doctor treating her told her
otherwise. At least it hadn't gone downhill, was the most hopeful
thing she could say.
"You know I'm here for you both," Cathline said, holding Kat's
hand in comfort.
Matthew nodded, "Yeah, thanks Cathline. I just wish all this hell
bitch's daughter thing hadn't come out. That's all we needed."
"Alex must feel as though we lied to him. It would look to him as
though we didn't trust him enough to tell him. That's not true at
all. It was between Elizabeth and him. It wasn't our business to
tell him, it was Elizabeth's," Kat said, and glanced towards
Elizabeth, still connecting to several machines and tubes.
"I know," Alex said from the doorway. He had gone to the coffee
machine and was now on his way back.
"Alex!" Cathline stood up and gave Alex a hug.
"Hey watch the coffee," Alex said, but returned the embrace all
the same.
Standing up from his seat nearest Elizabeth, Matthew said to
Alex, "Here have my seat."
"Thanks. Kat, I'm sorry for walking out like that. I was just in
shock, that's all. Why didn't she tell me?" Alex said softly.
"I dunno. Maybe she thought it wasn't important. Maybe she
thought who she was, was more important than where she
came from," Kat said in reply.
"I guess we'll never know," Alex said, and took hold of
Elizabeth's hand. Turning to Elizabeth, Alex said, "Why didn't
you tell me, silly! Did you think I would run just because of who
your mother was?"
Elizabeth said nothing in reply. Just the constant breathing and
beeping of the machines.
"We'll leave you to it," Matthew said. It was obvious Alex needed
to get this out of his system.
A tearful Alex just nodded his thanks.
Kat, Matthew and Cathline filed out of the room leaving Alex
alone.
"Hey Kiddo I brought you some stuffed toys down at the shop.
They didn't have Kweepa and Rooney in stock yet, but I'll pick
them up later for you," Alex fingered Elizabeth's engagement
ring as if reminding her that she was still his.
"I don't know if you can feel this ring still on your finger, but it's a
sign of our love for each other. It tells the world we are meant to
be. I don't care whose cells you came from, or what DNA you
have. I just want you back with me. Kat and Matthew showed
me and you that love can cross any boundaries, outlast the
fiercest fury and endure the greatest pain. If death is the final
boundary then love can cross that too. No matter what happens
I will love you until I finally join you at wherever we go when we
die. I might look a little older than you, but you'll always look as
you did that night on the beach, or when you put that ring on
your finger," Alex wiped fresh tears from his eyes.
"I know that's what mom holds on to, John's memory that is. It's
why she hasn't found anyone else and wont for the rest of life.
Yes, I know she had a thing for Kat and Dr Bexley, but deep
down she really loved John. I'm just like her; I mate for life. I
know how lonely she is, and how it eats into her, but she's got
me now, and that I think has almost made up for John not being
there. If she can spend her life alone, waiting to be reunited with
him then I can do the same. Elizabeth, I promise I WILL do the
same. When it's time to say goodbye I will take this ring from
your finger and wear it next to my heart, because that is where
you will always be," Alex fingered the ring once more and
clenched Elizabeth's hand tighter.
"We are soul mates, you and I. If our souls can't be together this
time around, maybe they will another. Maybe this life was just
them getting to know each other, and in the next life they'll meet
and have real party. You've just got to the party before me,
that's all. You can pour me a beer, get the best food from the
table and wait for me. To me it will be a lifetime, but to you I'll
just be a few moments behind."
Alex turned his head away and used his sleeve to brush away
the tears. Turning once more to Elizabeth he said, "I don't want
to wait until the next lifetime. I want you now! Prove me wrong
Kiddo. Prove to me that you don't want to meet me there just
yet. I dare you! You never could resist a dare from me could
you? So why are you chickening out now!"
Alex looked up at Elizabeth's face hoping to see a flicker of life,
but it remained still and deathly pale. Alex started to sob once
more "Come on God, fucking do something!" he swore in
desperation and despair.
There was no answer and Alex turned and kissed Elizabeth's
hand once more. Any hope that he had been holding was slowly
fading away. He realized that the sooner he faced up to
Elizabeth's death, the sooner he could move on and start to
rebuild. He glanced at Elizabeth's engagement ring. It would
soon be next to his heart forever, and Elizabeth would be gone.
-- o -- o -- o --
"I don't understand it!" Mark was telling Wills.
"What's not to understand? She dumped her car at the golf
course, left all her clothes behind in her room. There was milk in
the fridge, food in the pantry, and a half drunk cup of coffee on
the table. She's done a runner. Anne Baxter is no more, she's
gone off to start a new life under a different identity," Wills
explained.
"She told me she was working on something that would save
the global, marine ecosystem. It seemed the most important
thing in her life. We'd worked out we have less than sixty years
before it faced total collapse. There's no way she would run out
on that kind of problem," Mark said. Anne had seemed so
fanatical and secretive about her project, abandoning it didn't
seem to make sense.
"She can still carry it on elsewhere, under a different name."
Wills suggested.
Mark rubbed his face in thought "But she left all her research
behind. Her PDA, her E-library and her samples, everything. If it
was that important and it was, she would take it with her. It
would take years to get back to where she was now."
"I suppose. Did she send you any E-mail? A dear john?" Wills
asked.
"No, nothing. She just told me she loved me and then after I told
her how I felt she stormed off," Mark said.
"I just hope she's ok," Wills commented.
"Hah! 'Miss rip you limb from limb,' you can bet on it!" Mark
snapped. The hurt of Anne's actions and revelation still ran
surprisingly deep.
-- o -- o -- o --
The hospital board and the police were interviewing Anne. They
were trying to find out if she had been involved in Angela's
death, The interview had been going on for hours, and Anne
desperately wanted to go and see how Elizabeth was doing.
She had one final task to do before she left.
"Dr Williams, we've identified the cause of death."
"Was it cyanide?" Anne asked.
"Yes. It was held in a small capsule contained inside the lower
left molar. There were two small buttons embedded in the tooth,
one either side so as to avoid accidentally setting it off. The area
around the tooth hadn't healed properly so I guess it must have
been put in recently."
"So I'm free to go?"
"One last question. Why do you think she waited until you were
there to trigger it?" A policeman asked.
"It's my guess she wanted a witness. To ensure the world knew
about her suicide," Anne commented.
"Thank you Doctor Williams. It seems as though you did
everything you could, and were just in the wrong place at the
wrong time. We'll take care of everything from here on."
A few minutes later Anne walked out of the office. She made her
way to the intensive care unit and found where Elizabeth was
being treated. A young man she assumed was Cathline's
son was sitting there holding Elizabeth's hand, and whispering
into her ear. On hearing her walk in Alex looked
up, his deep brown eyes streaked with tears, and his face
utterly tired. Anne didn't want to shoo him away but he
clearly needed a break.
"I need to check on her condition. Would you mind leaving for a
few minutes," Anne asked.
"Can't I stay? I promised her I'd always be here. What if she
wakes up?" Alex asked.
"Then she'll still be here waiting for you," Anne said firmly.
"Doctor Atkins said I could stay," Alex protested.
Anne gave Alex a stern stare "Look, I admire your concern for
her. If she were my daughter sitting there then I would want you
to. But you look shattered, How much sleep have you had in the
last day or so? You'll be no use to her or your family if you burn
yourself out now."
"I suppose," Alex admitted. He stood up gave Elizabeth a
goodbye kiss, and taking a last look back at her walked out of
the room.
Anne checked over the readings on the life support systems.
There had been no change at all in her external condition but it
seemed as though the internal bleeding had been stopped fairly
quickly. That was good. Elizabeth's patient log showed that a
number of treatments had been discussed, including stem cell
rejuvenation, but the consensus was Elizabeth was too far gone
to respond. Anne had to concur with that prognosis. She looked
at Elizabeth lying on the bed; what could be seen thru the tubes
and breather mask showed that her face was peaceful and pain
free.
Anne walked to the door and flipped the sign across that said
'Do not enter, treatment in progress', and closed it. That should
keep Matthew, Kat and the others away for a while. She sat
down on the seat where Alex had been sitting and took hold of
Elizabeth's hand. "Elizabeth, I'm so sorry for putting you thru this
but it was the only way. If I had let you go then somebody would
have killed you there and then. That wouldn't have given anyone the
chance to say goodbye properly, and not given me the chance
to do what I have to do. Of all the things I have done in my life
this was the one that broke my heart the most. I will look back
fifty, a hundred years from now and know that I was the one
who probably allowed my only child to die."
Anne paused for a few moments, gathering her thoughts. "I can't
stay for long. I need to get back and get things moving on my
project. If I fail then we'll all lose our children and their children's
children. Elizabeth, I don't want to leave you but I have to. In all
those years of watching you grow up from afar I never stopped
loving you, never stopped wishing I could be there for you. And
the one time I was there it was too late. I'm in a dark pit and can see
no glimpse of sunlight. The man I loved, who treated
me like a real person, not some inhuman monster, has
turned out like all the others. I want to go back and see if he'll
try again. I don't blame him for the way he feels. It's not him, it's
me. This quote sums up how I feel. I know you can't hear me
but it does help me.
'You do me wrong to take me o' the grave: Thou art a
soul in bliss; but I am bound upon a wheel of fire, that
mine own tears do scald like molten lead."
Anne looked at Elizabeth's engagement ring on her hand and
smiled "It looks just like the one your dad gave me. I'm sure you
were as happy as I was when you were asked. Our fates are
linked, I think. We both need someone to pull us out of the dark
places where we are," With her other hand she gently gave
Elizabeth's hair a loving stroke, "I'm going to give you something
to help you on your way. It'll take time to work but it's for the
best."
Anne concentrated hard until sweat started to form on her brow.
Inside her body she could feel her changeling organ starting to
synthesize the chemical building blocks she required. She
nearly passed out under the strain of concentration, but a few
minutes later a small, needle like tube grew from her hand.
"I once gave Kat an old Egyptian blessing and it's stuck with me
ever since. I'm now passing it onto you."
Anne took Elizabeth's hand once more and stretched out her
lifeless arm. Tearfully she plunged the needle into Elizabeth's
arm and whispered, "May God go with you in all the dark places
where you must walk."
Within a few moments Elizabeth's already tenuous and weak
brain activity had started to fall. Anne pulled the needle out from
Elizabeth's arm, and it retracted back into her hand. She placed
Elizabeth's limp arm back inside the bed and stood up. Putting a
finger to her lips, and kissing it, she put it on Elizabeth's
exposed forehead. Anne checked the monitor screens and
already the brain activity was falling away. Anne looked around
for a pen and paper and saw one on the clipboard at the end of
Elizabeth's bed. She took it out and wrote down the same
blessing as she had given Elizabeth, and signed it 'Dr Anne
Williams'.
Trying to resist a sob, Anne fled out of the room.
-- o -- o -- o --
Kat's pager bleeped in the hotel room. She had been given it by
the hospital in case of a change in Elizabeth's condition. She
sprinted to it and saw a text message 'Please call - Urgent!'
"What is it?" Matthew asked.
"Quick pass me the phone," Kat demanded.
"Want me to wake Alex?" Cathline asked.
"No don't bother. He looks shattered. That doctor was right to
send him home. We'll wake him if we need to," Kat said softly.
This was hitting them all hard.
"Catch," Matthew said, throwing Kat the phone.
Kat quickly dialed the number and a few seconds later said "We
need to go in. Cathline, leave a note for Alex. He'll want to
come."
Within twenty minutes, they were inside another briefing room,
much like the one Kat had been shown when she had first got
there. Doctor Atkins and the neuro-consulant were present in
the room, both looking gaunt and sad.
"What is it?" Kat asked hardly daring to speak.
"There's been a change in Elizabeth's condition, and it's not a
good one. Over the last couple of hours her brain activity has
dropped below what we would call the 'threshold of life'."
Cathline let out a cry of despair. She knew what it meant.
"What are we talking about?" Matthew asked.
The consultant replied, "The normal brain has millions of
electrical pulses firing off every second. Elizabeth's has dropped
to one or two per minute. It's just random neurons firing as her
brain slowly dies. I'm so sorry, but her fight for life is over, from
now on it's just the machines. She gave her consent for her
organs to be used in the event of her death. Many more people
will be able to live because of her."
"NOOO!" Kat roared.
Matthew just held his heads in his hands and sobbed.
The neuro consultant handed Matthew a sheet of paper and a
pen. Matthew took it, and said, "What's this?"
Doctor Atkins explained in a deeply sorrowful tone, "This is the
form that gives us permission to switch the machines off. You
can choose whatever date and time you want to make sure
everyone is there who needs to be. It gives us permission to
remove whatever organs we need as soon as you have said
your goodbyes. The quicker we do this the more people will be
able to live full and happy lives because of her."
"Don't you dare sign it!" Kat snarled at Matthew.
"Kat. Please let go of her. She's gone," Cathline said tearfully.
"I will not let go because she isn't dead!" Kat snapped.
Matthew gave Kat a hug and said, "Kat, please let her go. I want
her to be alive as much as you do. But she's gone."
"You sign that form and the next form you'll be signing are our
divorce papers!" Kat's face was red with a mixture of despair,
sorrow and anger. From Kat's tone of voice Matthew knew this
wasn't an idle threat. She really meant it!
"Mrs Stephens, other people need that equipment. We had to fly
a small child who had been hit by a car, and was badly injured
to another hospital today, because our intensive care units are
full. If there were a glimmer of hope I would tell you. Please let
your daughter go. There's nothing we can do for her now. For
the sake of others, and yourself please let us do this." Doctor
Atkins had seen resistance and denial like this countless times
before. It was a natural reaction and it was best to let it burn
itself out.
"I'll buy you a hundred fucking machines, I'll build an entire ward
for you, just don't switch off those machines," Kat demanded.
"Kat, let her go," Cathline said softly.
"NO!"
"Please. For her sake and ours," Cathline said tearfully.
"NO!!" Kat's denial was more forceful than the last.
"How long can we wait before signing the forms?" Matthew
asked doctor Atkins.
"We can keep her body functioning indefinitely, but we are
beyond the point where it becomes of any use. Practically, we
need those machines now."
"Not good enough!" Kat snapped.
"Kat, please," Cathline pleaded.
"No they can take me to court if they want, but I absolutely do
not give my permission for this!" Kat said with all her will.
"Kat I've never known you so selfish. LET HER GO!" Matthew
pleaded.
"Selfish? Not killing our own daughter? I hardly call that selfish!"
Kat shouted at Matthew.
"Kat she's already..." Matthew started to say.
"Don't say it! If you finish that sentence than that's it between us.
Forget thirty five years of being married and what we all went
thru. If you make me do this then that's IT!" Kat's eyes were red
with tears.
Matthew stayed silent. Kat was serious. There wasn't much that
could drive her away from him but if he acted against her wishes
in this then he would lose her and as well as Elizabeth. That
was something he wasn't prepared to do. He had to give Kat
time to overcome the shock she was feeling. Kat was in denial,
he knew that, but she needed him more than ever and he
needed her. There had to be another way. Then it came to him
"It would take a few weeks to get a court order, correct?"
Dr Atkins nodded, "Yes it would."
Matthew turned to Kat and put his hand on hers "We'll give it six
weeks. If anyone needs that equipment we will pay for them to
use whatever facilities they need, Euro-health service or private,
it doesn't matter. If you need more staff hire them, whatever it
takes."
Kat nodded her agreement. "If there's no change in six weeks
then I'll agree." As soon as she said it, she burst into tears,
turned and gave Matthew a 'protect me' hug.
Doctor Atkins said, "One more thing. The doctor who discovered
her condition wrote you a message. I guess she knew what was
going to happen, and sought to bring comfort to you. It's a single
sentence and simply says 'May God go with you in all the dark
places where you must walk.'"
Through her tears Kat gave a smile. "Tell her thanks. A friend
told me the very same thing years ago. It stood me in good
stead then and I'm sure it will now. Cathline, Matthew let's give
Alex a call. He'll want to come."
-- o -- o -- o --
Anne packed her bag and checked out of the hotel. She had
cried all the way home, but there had been no other choice. No
choice what so ever. On the way back she had made up her
mind. She would go back to Mark. He was the only person she
had left that she could go to. She needed to be near his
innocence; it was the only way out of the darkness she was in.
She had lived for years in the shadows of her mind and her past
and now they had consumed her. Her final monologue with
Elizabeth had shown her the way. If she continued the way she
was, only death, despair and darkness would remain. She had
just enough hope left inside her to believe that there was more
to her fate than that cold, lifeless existence.
Anne changed forms into Anne Baxter at Heathrow terminal six
ladies room. Her thoughts went back to that hospital room
where Elizabeth lay, back to a weeping Matthew, Kat and Alex,
and how devastated they must be feeling. Nothing she could
think of could bring her any joy any more, her only thoughts
were of the words from King Lear she had spoken to Elizabeth
"You do me wrong to take me o' the grave: Thou art a
soul in bliss; but I am bound upon a wheel of fire, that
mine own tears do scald like molten lead."
It would be a long flight and journey back to Haverford, so
she tried to rest before the flight. At times like this she
wished she still had use of the Aurora, but she wasn't sure she
could face another gut wrenching journey.
Ten long hours later she paid the pound to release her car, gave
a basic set of answers to the police, and drove back to her
dorm. Mark had to take her back and this time she wouldn't take
no for an answer.
-- o -- o -- o --
Mark was just in the middle of brushing his teeth when he
heard a loud knock at the door. Quickly rinsing his mouth out
and washing the spittle down the sink he ran to the door, "Ok
Wills I'm coming he called."
Mark flung open the door and saw Anne standing in front of him.
Mark thought she looked tired and worn out. Her normally
flawless face had dark rings around her eyes, and her hair
looked as though it could do with a wash. Anne was normally
impeccably dressed, with every article of clothing carefully
matched, but she looked as though she was wearing clothes a
size too small that hadn't ever seen an iron. It was the
oldest and saddest Mark had ever seen her look.
Anne spoke first; aware that she looked a mess "Can I come in.
I need to talk."
Mark was about to tell her to go away, but the once infallible Dr
Bexley, the woman who had changed the world forever, and
had slain a gang who was going to kill them, now looked as
vulnerable as a child. He wasn't sure if it was an act or not but
he couldn't ignore her, not now. "Sure, come in."
Anne gave a smile. "Thanks," she said, and walked inside.
"Coffee?" Mark asked nervously. Why was she here?
Anne shook her head, "No thanks. I drank loads on the plane
back so I only had a couple of hours sleep."
So she went overseas, Mark thought. Mark sat down on the
opposite armchair to where Anne was sitting. "You look
exhausted. Why not go back to bed."
"I needed to see you," Anne said softly.
"Why? I think we said all that we needed to say don't you?"
Mark stated. A few days after she had left, the numbness that
comes from a broken heart at started to set in. The last thing he
wanted to do was reopen the wounds again.
"Please," Anne pleaded.
"Look. I've got a tutorial in about twenty minutes. What about
after classes? That'll give you some time to freshen up and
have a rest," Mark said. Why did Anne, sorry Dr Bexley look so
mentally tired? It was as though all the life had been drained out
of her and all that was left was an empty shell.
Anne nodded. It could wait till later "I'll meet you at the beach.
Where we had our first date. At say six?"
Mark nodded his agreement. "Ok. It'll give me chance to collect
all the stuff you leant me as well. It'll save you a job later on," In
the meantime he would send a note to Wills asking him to
explain the truth about Anne Baxter to the world if he didn't
return and give a code word. He was going to take no chances
at all.
-- o -- o -- o --
"So we have six weeks," Alex said tearfully. The rest of the
family had driven back to the hotel to find Alex getting ready to
leave for the hospital.
"That's all we could get. I'm sorry." Kat took hold of Alex's hand
for comfort.
"So that's it. She's dead," Alex said bitterly.
Matthew nodded his head, "I'm afraid so. Any brain activity there
is just the random firing of neurons as her brain slowly breaks
down."
Cathline moved over and gave Alex a hug "We'll get thru this
together just like we always have."
"It was only a week ago we were having punt races on the river
Cam. I still can't believe she's dead," Alex wiped away some
fresh tears.
"She not dead. I keep telling you. Why won't you believe me!"
Kat snapped.
Matthew gave a sigh. "Kat I'm saying nothing. We said all there
is to say back at the hospital.
"Good!"
Cathline tried to defuse the situation. "Look, John's flying over
tomorrow. We need to be there for him too. He's only just found
out about the whole thing, so we all need to help him cope.
We've had 48 hours to adjust to this. He's still trying understand
how and why he's lost his sister."
"He hasn't lost his.." Kat started to say.
Alex reached over and took Kat's hand "Kat, you don't need to
be strong for me. I know she's gone. If you don't let her go you'll
only end up very ill and none of us need that. You need to start
dealing with this properly, not deny it out of hand and get angry
at anyone who disagrees with you."
On hearing this, grief welled up inside Kat and she let out a loud
sob, "I'm sorry, maybe I am in denial, but part of me refuses to
believe that she's dead. We have six weeks before they switch
off the machines and I mean to make the most of them."
"Why did they do this to her?" Alex asked in disbelief
"Who. The Children of Bexley?" Matthew asked. He had been
wondering the same thing.
"The police thought they might have tried to persuade her to join
them. It doesn't matter now, does it," Cathline explained to John.
"I never had Angela down as the type. She seemed so nice.
Elizabeth thought the world of her. She was going to be one of
our bridesmaids." Alex turned and walked towards the hotel
room window. Night had long fallen and the orange sodium glow
of the streetlight's cast shimmering patterns on the roads. It had
rained as they had come back from the hospital, which echoed
the tears Alex felt form in his eyes.
"Who knew? I heard she killed herself this morning. Couldn't
face trial and the humiliation of the cult or so I heard. Why in hell
did Elizabeth try and escape?" Matthew asked. Once again the
empty, lost feeling he'd been having all day had nearly
overwhelmed him.
"Because she takes after her mother," Kat said softly.
"She was her mother's daughter alright," Cathline agreed.
Matthew put his arm around Kat and drew her close. He ignored
Kat's use of the present tense. "We need an early night. We still
have a long way to go, and this is only the second day."
-- o -- o -- o --
Anne sat herself down on the beach and proceeded to wait for
Mark to arrive. She'd had a long relaxing bubble bath and had
taken the time to do her hair properly. She found that she had
been unable to sleep. Her mind was on Mark, and on Elizabeth so
many miles away. His reaction earlier on in the day was a
severe blow. He still wanted to break up, she just hoped he'd
turn up. She checked her watch, it was now six thirty and Mark
was half an hour late. With a sigh of resignation she stood up
and walked towards her car.
She reached her car and found a small parcel on the front seat.
On it was a small note with a single word, 'Elizabeth' written on
it. She recognized the handwriting. It belonged to Mark. Sadly
she opened the driver's door and got inside. Reaching over, she
picked up the letter and opened it.
"Dear Elizabeth"
Here are the things you lent me during our time together. I
wanted to get them back to you as soon as I could. Please
forgive my not turning up. I couldn't face seeing you again. The
last few days have been the most painful of my life, but I realize
that we are too different to be together. When I saw you
standing outside my room today, part of me wanted you back
but I knew then that we're not meant to be.
I spent months wishing I could get to know you, but you're not
the woman I fell in love with. She was just an act, a role for you
to play. That's what hurts most of all, the woman I fell in love
with wasn't real. She was a creation, made up by you.
How can I forget who you are? How can we go back to how we
were before? We can't. Too much has happened for that to be
possible.
I don't feel betrayed. You stayed when you could have
just vanished into the night. What you told me the other night
took real courage.
I know you have a busy month or so. So do I. Whatever you are
planning to do, I hope to God it works because we need it. I've
mailed you my latest research, and I hope that it's of use to you.
We both leave here in about eight weeks, and I expect we'll
meet again at some conference. When we do, we'll be able to
chat about all the fun we had and how things may have
advanced. Please don't worry about me saying anything to
anyone -- your secret is safe with me.
I'm not making myself too clear so please forgive me. I'm just
trying to stop things before they got too far and hurt us more.
I'm sure that there's someone out there for you. I'm just not sure
that person is me.
Mark"
Anne tearfully put the note down. It was over. She had at most
two painful months left before she finished here, but she
decided that she would pack up and leave as soon as
everything was ready. She was sure Tel-Aviv would take her
back and the delay in the project wouldn't be that great. It would
be fitting for Tel-Aviv, the site of her greatest failure, to be the
place of her greatest triumph. She couldn't bear to be at the
college campus any longer. Her pain was too great. Everywhere
she walked she would remember being there with Mark, and of
the last best hope he represented. She would pack only her
notes, other essentials, and get the rest sent later on. She could
be out of here in less than two hours.
Her paper had a month of solid work left on it before it was
ready. She would need to prepare samples, document
everything she had ever done and ensure there was a complete
and accurate audit trail of everything she had worked on. Her
paper would face the full spotlight of a skeptical scientific
community when it was published and she had to be ready for it.
In a way it was just as well Mark hadn't shown, she wouldn't be
able to pay him much attention anyway. But she had
desperately hoped to be able to patch things up beforehand.
Fresh tears formed in her eyes, born from a forever broken
heart. She switched the engine on and drove off
From Wills's car parked the other side of the road Mark and
Wills watched Anne drive off. Mark said nothing for a few
moments, before turning to Wills and saying, "Come on we'd
better go."
Wills turned to look at Mark. Mark's face looked deeply sad,
there were deep worry lines around his eyes. He looked sadder
than Wills had ever seen him. Even more so when he'd read
about when Anne was missing after the boat accident. "We can
still go after her," he said.
Mark shook his head, "No. It's for the best. We'd never catch her
anyway. Why couldn't she be just a normal girl?"
Wills started the engine and slowly drew away from the side of
the road "Because, she's not a normal girl. If she were you
would never have noticed her. You spent months telling me how
unique and special she was. What did you call her, that's right
an 'Uber Babe'."
"That was before she turned out to be a inhuman killer," Mark
snapped.
Wills indicated to turn left and joined the freeway once he was
on it he turned and said to Mark, "From what I saw of her she
was everything you described and more. You didn't fall in love
with Anne Baxter you fell in love with her, Dr Elizabeth Bexley.
I've just realized that you were very, very wrong about her,"
Wills wanted to have his say and switched off the auto-nav, the
last thing he wanted was for it to keep interrupting him. What he
had to say to Mark was important.
"How so?" Mark asked.
"She wasn't play acting, nobody is that good. That was how she
really was. Anne Baxter wasn't just a name for Dr Bexley to hide
under. It was how she really is. Don't you see she wasn't trying
to hide? She was trying to rebuild her life. That's why she went
back to college, built a whole life around Anne Baxter and
eventually fell in love with a complete idiot called Mark."
"You heard the news the other day. The cops are going ape
about it. They've issued an appeal for witnesses because they
don't have any. I was going to call in. 'Yes Officer I know who
ripped those men apart; it was my pissed off girlfriend'. You
didn't see her rip those guys apart; it was horrific." Mark said
bitterly.
Wills's sense of frustration was growing, "No I didn't. But you
know what I'm glad she did it, because in that one incident she
showed you how much she loved you. She put everything she
had on the line for you that night. She risked everything she had
done as Anne Baxter, her mysterious project, her entire life was
laid bare for you. Sure, she could have just called the cops, run
away, or even stunned those guys, but she didn't. In one
moment she said 'Here's who I really am. I love and trust you
enough not to hurt me or betray me'. That's hard enough for
anyone to do let alone her."
"But she never said anything to m.." Mark started to say.
"Yes she did! She told you she loved you, and you've gone and
thrown that right back at her."
"But.." Mark started to say
Wills interrupted again his voice "For fucks sake, Mark! For
nearly a year I've watched you mope around and wallow in self
pity over that girl and not once told you to get a life. Now I am.
You nearly failed your course because you were too distracted
by her, and in fact she saved you didn't she? I've never seen
you like this about anyone before. Not even me and we've been
friends since the age of five! You don't feel like that about just
anyone, Mark, and you don't throw it away because of what
people did years ago. It's how they are now and what they are
like now that matters. From what I've seen of Dr Bexley she is
everything you yearned for, for months and more besides."
"But she kill...."
"Don't interrupt me! I've told you why I think she did what she
did and from her actions after that I know I'm right. Deep down
you do too. So do we go back to campus and you can live out
your life wondering what if, or do we go find her and you can tell
her what a full sized dickhead you've been."
Mark gave a deep sigh. Wills was right. He did still love her.
Why else did he feel so sad and guilty about leaving the note?
Why else had he stayed behind to watch Anne as she had
picked it up and driven off? If he still didn't love her then why,
back at his dorm this morning didn't he want to open the wounds
again? Why had he tried to talk himself out of being with her
when all he'd done all year was yearn to be with her? The only
answers to these questions were that he still loved her. He had
always loved her and always would! "Let's go find her. I'll see
what she has to say," Mark said softly.
Wills gave a smile "Even complete dickheads get it right
sometimes."
Suddenly in front of them a concertina of brake lights flicked on
from car to car. Wills swore quietly. He'd wanted him and Mark
to have some peace and quiet, so he'd turned the auto-nav off
and now he was caught in some kind of traffic jam. "Fuck it,"
Wills swore and switched the auto-nav back on
Straight away the dulcet female tones of the auto-nav said "Wills
you have stationary traffic for six miles. A Tanker has overturned
at intersection 15. The estimated delay is two hours. Would you
like some music?"
"Fuck," Mark replied. Typical! He fished his PDA out and started
to write Anne an E-mail. If he couldn't be there in person he'd
send a letter.
-- o -- o -- o --
Anne had just finished packing the last of her clothes into her
suitcase and was now composing a transfer request letter to
send to the dean and Tel-Aviv. She'd managed to get a last
minute platinum class flight to Tel-Aviv from JFK leaving the
next day. She didn't want to spend that amount of money, but
otherwise she'd be facing a three or four day delay for a
standard seat. She just needed to get away from this whole
thing. She had debated flying back to England to see Elizabeth,
but she knew there was nothing she could do for her now. Every
visit she made to the hospital she risked being found out and
that was too much of a risk for her to take right now. Besides, it
was nearing the long summer vacation, soon the various
experts she needed to court would be away from their research
labs, and the whole process would slow down for another three
months or so. She took a look around once more at the place
she'd called home for two years. It hadn't been a bad place to
live, certainly more comfortable than many other places she'd
been.
Her mind went back to her torture and killing of the cult leader.
She'd felt justified at the time. The clock was ticking for
Elizabeth and she had no time to waste. In retrospect it seemed
brutal and cruel, like something that that monster Deianeria
would do. How much different had Deianeria's vivid description
of the cruel sex, rape, killing and mutilation of her family been
compared to the death by vivisection she'd performed on the cult
leader? The stark truth was none at all. Although she could claim
the moral high ground by claiming it saved a life, in reality she
had done it out of anger, fury and fear for her daughter's life.
This time around she couldn't blame her MPD as she had been cured
for twenty years. Mark was right, she was inherently a merciless
killer. Deianeria and her were one and the same.
The thought disturbed her a great deal. Mark had been right not
to show. How could he ever love someone like her? Not after all
she'd done that was for certain. How would he react when she
told him of her recent activities? Especially that she'd slowly and
methodically dissected a living human being in order to get
information. She heard a bleep from her PDA, which was sitting
on the bed and had been waiting to be put into her hand
luggage.
"Anne, You have one message from Mark Andrews," the female
voice of the PDA called.
Anne thought for a moment. It didn't matter what Mark said or
wrote. The fact was that she was just as much of a monster as
she had been all those years ago. The motives might have
changed, but the method and disregard for human life hadn't.
Mark was worth more than she could give him. "PDA Delete and
erase mail. Disregard all future mail from Mark Andrews."
It was so easy for her to say the words that would wipe away
four months of hope for her but inside it was horrifically
depressing. She had come back hoping to find a ray of hope for
her but instead had only found the death of her dreams and the
death of that hope. She placed the PDA inside her hand
luggage and walked to her car. It would be a long drive but she
knew she could keep going all night if she had to. Once she
started work in Tel-Aviv then it would all work out, it had to
because that was the only thing she had left!
-- o -- o -- o --
Wills and Mark cleared the traffic some ninety minutes later.
Wills had parked his car as close to Anne's dorm as he could,
but had noticed that Anne's car had gone. Mark had said that it
didn't mean anything. Maybe she'd had to park it at a more
distant lot and walked the rest of the way. Wills however wasn't
so sure. As soon as Wills's car had drawn to a stop Mark
pushed open the door and sprinted to Anne's dorm. A few
seconds later Wills was in hot pursuit. Not wanting to wait for the
elevator, Mark ran up the five flights of stairs and almost skidded
to a halt outside of Anne's door. "Anne, Hey open up." Mark
gasped.
There was no answer.
"Hey Anne. Open up we need to talk," Mark shouted thru the
keyhole. Mark peered inside the room. It was dimly lit inside and
that didn't hold out much hope that Anne was inside.
"Anne. Come on please," Mark pleaded.
Mark heard some footsteps behind him and whirled around,
hoping it was Anne, but to his dismay it was only Wills emerging
from the elevator.
"Not there huh?" Wills asked.
Mark gave a sigh, "Doesn't look like it!" Until this point he'd been
full of hope that he could patch things up with Anne, but now
she'd gone.
Wills tried to cheer Mark up. "Let's try the lab. Maybe she's
there?"
Mark smiled, "Oh course! Let's go!"
This time both of them took the elevator and sprinted across the
lawn towards the science faculty. They arrived there a few
minutes later, and found the doors locked and the lights off. At
the sight of this Mark shook his head in defeat and sat down on
the steps leading up the to building. He was too late.
Wills gave Mark a comforting look, "Look she's probably just
gone off to think. We'll try again in the morning."
Mark felt relieved "Ok."
-- o -- o -- o --
The next day Mark and Wills tried Anne's dorm once more.
Much to Mark's dismay there was still no answer to his repeated
callings. A quick trip to the science faculty proved fruitless, as
did a search of all the college's allocated car lots. In desperation
Mark sent an email to Anne's faculty head asking for information
on her. The police weren't interested until twenty four hours
were up so it came down to Wills and Mark to find out where
she had gone to. So they sat outside the science faculty
wondering what to do next.
"I know where she's gone," Wills said, looking at the screen of
his PDA.
"Where?" Mark asked expectantly.
Wills pointed at the screen of his PDA. "She's gone to be with
her daughter."
"Daughter?" Mark was stunned. Since when had Dr Bexley ever
had a daughter?
"Oh Mark! We can get up-to-the-second information, and net
access points are everywhere we go, and you seem to move
around in blissful ignorance. It turns out that Elizabeth Stephens
is really Dr Bexley's daughter. She cloned herself years ago and
impregnated Jane Stephens with the embryo or something.
Anyway Elizabeth Stephens was kidnapped a few days ago and
was killed while trying to escape. Well just about killed, she's in
a coma and only bio-support is keeping her alive," Wills
explained. Sometimes he wondered what planet Mark lived on.
"Fucking hell. Poor Anne. No wonder she looked beat when I
saw her. I bet that's where she went for those few days. She
came back to see if I would have her back and then when I
wouldn't she's gone back to be with her daughter again," Mark's
stomach felt sick. The fact that his girlfriend had a daughter the
same age as him was hard enough to take in, but in Anne's time
of greatest need he had thrown it back in her face. But how was
he supposed to know? He just wanted to be with her again, to
help her come to terms with the death of her daughter, and to try
and put their lives back on track. From what Wills had just read
Anne really would need all the help she could get. Help that he
had thrown back at her.
"How do you feel?" Wills asked.
Mark sighed, "Like I've kicked her in the teeth. She came back
for me to help her and I kicked it right back at her. Why do I
always screw up when it comes to her? I checked my mail this
morning. She deleted my mail without even opening it. I sent
another but it came back as blocked. I don't blame her for doing
it. I hurt her more than I thought. What am I going to do Wills?"
"We're going to find her and you are going to work this out,"
Wills said determinedly.
"I guess. Look why don't we go see the faculty head in person.
Maybe he knows something by now," Mark said. His sprits had
risen a little by Will's pep talk.
A bleep came from Mark's PDA and he quickly took it out of his
pocket. "It's from the faculty head. That was quick."
"What's it say?" Wills said excitedly.
Mark read it out "To Mark Andrews, from Blah blah. Here we go.
Elizabeth Anne Baxter has requested a transfer to Tel-Aviv.
Please forward your important family news to
services@telaviv.edu."
"She's gone to Tel-Aviv?" Wills asked.
"I guess she wanted to finish her work away from me," Mark
said glumly.
"At least you know where she is. All you need to do is book
yourself on a flight and go meet her!" Wills stated.
Mark's spirits rose. Still holding his PDA he said "PDA what's
the next available flight to Tel-Aviv?"
There was a few moments silence and then a silky female voice
said, "The next flight with available seats is four days from now."
"Four days! PDA, what about standby seats. How much are we
talking about?"
A few more moments of silence as Mark's PDA interrogated the
airlines booking systems "Standby seats with only a 20%
chance of departure are available two days from now at a price
of two thousand dollars! Standard price seats flying economy
class are available at four thousand dollars. There is a ten
percent deposit for all seat reservations"
Mark shook his head in disappointment "Well that's it then! It
may as well be four million dollars! I can't afford four hundred let
alone four thousand! I know Mom and Dad can't either. Where in
hell am I going to get that kind of money?"
"From me," Wills said quietly.
"You haven't got that kind of money either!" Mark complained.
"Yes, I have if I sell my car. I should get 6K for it. That's enough
to send you to her and enough for me to get another car."
"Wills, I can't ask you..." Mark started to say.
Wills gave Mark's shoulder a friendly pat, "You don't have to ask
me. Look, we've been friends for nearly twenty years. If Anne is
anything like the woman I know she is, she's worth every cent."
"Will's I don't know what to say," Mark said. He was nearly
moved to tears by Wills generosity.
Wills smiled "You can tell Anne you love her. That's enough for
me. Go ahead, make the reservation. It'll take me a few days to
sell the car. Anne will still be settling in, so you've got a good
chance of meeting her there. What's your credit limit at the
moment?"
Mark shrugged. He hadn't a clue, "PDA what's my current credit
limit?"
The PDA replied a few seconds later "Your credit limit is four
hundred and twenty dollars"
Mark smiled "PDA reserve me one open ended return to Tel-
Aviv. Standard class leaving five days from now. Use Visa card
1 for reservation deposit"
The PDA beeped for a moment. It would take a few minutes to
check all the details.
"There we go. Sorted!" Wills smiled.
"YES!" Mark punched the air with a clenched fist.
The celebrations were cut short by Mark's PDA "I'm sorry.
Travel visa to Israel denied!"
"PDA, Why in hell. I've got a valid visa for all travel," Mark
complained
The PDA continued "Visa denied because of previous visit to
Egypt less than one year ago. A new Visa will need to be
obtained alongside appropriate security clearances."
"Fucking field trip!" Mark swore. He'd been denied because of
the field trip to Egypt some months before!
"PDA how long to obtain a new visa?" Mark asked. His heart
was in his mouth. It could be months if at all.
The PDA was silent for a few minutes until it spoke once more
"Israeli immigration database indicates that the lead time is a
maximum of eight weeks. "
"Eight Weeks! She'll be long gone by then!" Mark complained.
His dreams of getting back with Anne were slipping away.
"First things first. Apply for the visa, let me sell my car and the
rest is down to fate," Wills said in a matter of fact manner. It was
going to be a long two months for the both of them.
"At least it'll give me chance to finish my dissertation before I go.
I might even stand a chance of getting a Ph.D. by then," Mark
tried to look on the bright side of things. It worked, but only up to
a point.
Wills gave Mark wry smile, "Come on old friend. I'd better enjoy
my car while I've still got it. "
-- o -- o -- o --
It had been one of the longest weeks Kat had ever endured.
John had arrived a few days ago and had immediately broken
down in tears. It had fallen to Kat to try and comfort him as only
a mother can, but in the end she felt as sad as he did. Elizabeth
had shown no improvement at all, and although they hadn't said
anything she knew the doctors desperately needed the
equipment. In her heart, she knew that there was still some
hope for Elizabeth. There had to be, because the alternative
was too awful to contemplate.
She had calmed down from her initial reaction. The shock had
given way to stoic determination. For his part Matthew was
standing by her, comforting where she needed it, supporting in
the quiet times and a shoulder to cry on for the rest of the times.
Cathline was trying her hardest to comfort Alex who had nearly
burnt himself out with his constant vigils. In the end they had
settled on a six hour rota, so that Elizabeth would always have
those she loved around her. Alex had been able to get some
welcome rest, and now as Kat walked in to take over from
Cathline it she thought about what she would say to Elizabeth.
They had made a policy decision not to speak about the
sadness they felt, only about the good times they had shared
together.
As Kat walked into the IC room, she saw Cathline still holding
Elizabeth's hand. On hearing Kat walk in Cathline looked up, her
one good eye streaked with tears. Cathline shook her head as if
to say 'no change'. For her part Kat just nodded sadly and
swapped seats with Cathline. Normally Cathline looked radiant,
improbably beautiful but the strain was showing on her face.
Cathline gave Kat a comforting pat on the shoulder and left, she
was too tired to speak.
Kat took hold of Elizabeth's hand and started to speak.
"I Remember when I first found out you were inside me. It was
quite a shock I can tell you, but seconds after I was told I knew I
had to keep you. How could I kill a new life that was growing
inside me, even if you weren't mine? As you grew so did my
love for you. I remember running to Matthew after I'd felt your
first kick, and demanding he feel it too. We used to talk to you
every night when you were inside me. Telling you what a special
girl you were going to be."
Kat paused for a few moments, remembering the feelings of
motherhood. Gathering her thoughts she continued, "I'll admit
you didn't come easy into the world. We thought we'd lost you
for one moment but you fought back and lived. You're like your
mother that way, a survivor."
Thoughts of those panicked few seconds, when a newly born
Elizabeth had stopped breathing, came back to Kat. Much to
Matthew and Kat's relief Elizabeth had decided to start
breathing again, and the emergency had passed. Kat resumed
"It was hard at first being a parent. Still, with each passing day
our love for you grew and grew. Matthew was there to see your
first smile, the first time you rolled over and your first steps. He's
very proud of you. Sure, as a toddler you had an awful temper
on you, but you always seemed to know how far to push us. We
all had a hard time when you started school. You being the
daughter of such famous parents and us saying goodbye to you
every day. We knew you were special when you started to ace
every test you were given. It wasn't until we had the blood and
brain tests done did we know how special you are."
She remembered the look of horror on Matthew's face as they
were told the news. She felt the same, but deep down her love
for Elizabeth stood firm. That day she had vowed to treat
Elizabeth as her own flesh and blood daughter and not make
the mistakes Dr Bexley's parents had. They had been
outraged when they were told in no uncertain terms that
Elizabeth would be confined for her own safety and that of
others, should she exhibit the same behavior as Dr Bexley.
In the end they had reached a compromise. Cathline would act
as the counterbalance, and would decide if and when to notify
the authorities. From that time on Cathline had been nearly as
involved in Elizabeth's upbringing as Matthew and herself. Kat
continued to speak to the lifeless Elizabeth, "It's not the major
things I miss. It's the thousand little things, like the way you and
Alex used to feud. Each of you trying to out maneuver the other.
Like when you decided to go brunette for a week, those kind of
things. They add up to an experience that I would never give up
for anything in the world. I always wanted to be a mom and you
know what? It's more than lived up to my dreams. You have
more than lived up to my dreams and expectations," Kat gave
Elizabeth's hand a squeeze. She checked her watch, only five
hours and fifty minutes to go. Her optimism at the start of the
week was starting to fade, but from being Elizabeth's mom for
the past twenty two years she knew one thing. Elizabeth
wouldn't give in without a fight, but she had to admit this might
be one fight she couldn't win.
-- o -- o -- o --
If the first week was hard on Kat then the next month was even
worse. The daily vigils had continued to no discernable effect on
Elizabeth, and now even the stoic Kat was starting to think it
was all over. They now had only four days left before the
machines were switched off and it was a deadline that prayed
on all their minds. In fact if that day's readings on the bio-
support systems were to be believed, then Elizabeth's body was
in the process of dying, in spite of the machines. The effort the
bio-support systems took to keep her alive had increased by
some 17% over the last few hours, and the doctors had told
them it was a sign that the end was close at hand. Kat had
allowed Matthew to start making the funeral arrangements.
Elizabeth would be buried in the tomb where Salah had been
laid to rest. Her friends from Cambridge had already been
notified of the date and arrangements made to fly them to the
island where Elizabeth would be buried.
Matthew had set the date for two weeks from now, which would
give them enough time to bring Elizabeth's body back, and
prepare it for burial. Alex had asked them if he could keep the
engagement ring he'd given her, and of course they had agreed.
Elizabeth would be buried in her favorite outfit, the one she had
bought for the meal at the London Hilton. From all around the
world messages and get well cards had been pouring in to the
hospital. It was good to see that so many people cared about
them. Flowers had been arriving every day from people they
had never met. So many in fact, that Kat had, had to employ
some few administrators to note down the names of the well
wishers. Kat vowed to write to everyone in person to thank them
personally. It meant more to her than she could say.
Matthew and her had been asked for several interviews for the
TV and webcasts, but had politely declined. This was a private
moment and they didn't want to share it. They would issue a
press statement in a few days time to thank all those who had
offered support and to congratulate the medical team there.
Kat's hope had all but faded, but she had just enough
determination to refuse to have the machine's switched off early.
They had gone this far, so another four days wouldn't matter.
Matthew and she had scheduled Elizabeth's time of death to
be at 13:18. This was the time she was born, and it gave a
certain sense symmetry to her life.
Kat had been impressed with Alex. He had stood beside
Elizabeth every hour he could get away with, and had been on
hand to provide advice and comfort to them all. He was so like
Cathline it was unreal. She was glad he was there. In the last
few months he had changed from the immature joker to a
mature young man. He and Elizabeth would have been so
perfect together. When she had seen them together it was just
like she and Matthew had been. But now the dream was over,
shattered by a single gunshot from a fanatical organization.
Nobody had seen the Children of Bexley cult leader for weeks
and it was thought he was on the run. The cult had denied all
knowledge of the kidnap, but it's records and assets had been
impounded on both sides of the Atlantic. She'd had a strange
message from the Guild stating that Salah's body had been
exhumed and was undergoing tests. Kat had no idea where that
had come from, only that Elizabeth had requested it be
performed a few months back. Kat guessed it was part of
Elizabeth's project she had been running after her first
semester. The message had also implied that the Guild knew
what to do with the information, so Kat just let it go. The Bexley
cult had been the bane of their lives for years and now it
seemed as though they had taken their adoration too far. She
was sure it wasn't the whole cult, only a few crackpots but that
was all it took to end her daughter's life.
At least it looked as though the Bexley cult was finished. After
they had fucked up the kidnap, people were apparently leaving
in droves, disillusioned with the whole thing. Kat was pleased,
but that didn't bring Elizabeth back. Matthew and Cathline
shared Kat's feelings on this, but Alex was finding it hard to
understand why they would do anything like this. Sure he
understood in his head, but his heart was still some way behind.
John too, was finding it hard to come to terms with the death of
his sister, but he had tried to busy himself in the detail of the
funeral arrangements. Kat kept a watchful eye on him in this,
making sure he didn't bottle up how he really felt. John was a lot
like Matthew in that respect. Matthew would bottle things up until
he snapped and John would have done the same.
Elizabeth's burial clothes would be here tomorrow and Kat and
the others still had a lot to do.
-- o -- o -- o --
Wills ran up the stairs to Mark's dorm. With a loud staccato
knock he banged on the door. It took Mark a few minutes to
answer "Hey Wills wass up?"
Wills smiled, "I've just transferred four thousand dollars into your
account. I did a great deal on the car, so I've got a bit more than
I wanted but all the better."
Mark punched the air "Wills I could kiss you."
"People will talk, and besides, what would Anne say?" Wills
smiled.
Mark laughed. "Guess what? My visa's due next week so I can
go ahead and book."
Wills walked inside Mark's dorm and sat down. "Any news from
Anne?"
Mark shook his head, "Nope. I know she's arrived and the
transfer's been agreed, but she's still blocking my mails. All her
samples went over last week, so I guess she's still working on
whatever she's working on. I've tried calling the university but
they won't give out personal details over the phone. I've waited
this long I guess it won't matter if I wait a little longer."
-- o -- o -- o --
Anne checked the clock on the wall. She had been working a
solid fifteen hours today, and she was starting to feel tired. Her
PDA had told her that Mark had tried to mail her every day for
the past five weeks, and that the PDA had blocked and deleted
every single one. She had managed to hide her pain in her
work and had fallen back on her old escape route of pushing her
mind and body to the very limits. She was so close to finishing.
She just had to validate the effects on the food chain and she
would be done. There would be plenty of time for rebuilding
afterwards.
She had noted with dismay that Elizabeth's bio support systems
were due to be switched off in two days time, and that thought
did nothing to ease her depression. She had kept a happy face
on for her colleagues but it was so hard to keep up the facade. It
was now too late to do anything about Elizabeth. But did Mark
want a reconciliation? The Mark situation she could do
something about if she wished but did she want to? She'd had a
month to debate her choice to leave him behind, and now in the
cold light of day it she saw it to be the correct one.
She had shown no mercy to the cult leader and the gang
members. Mark was right. It was in her nature to be utterly
ruthless. Mark needed someone who was compassionate and
caring. Someone who he could love as much as they loved him.
As much as it hurt Anne to admit she wasn't that person. Sure
she cared deeply about the people she loved, but there was a
ruthless and vicious side of her that she hated and knew Mark
did too. Whatever he might feel at the moment she knew that
when he found out about her activities then the whole thing
would blow up again. For a while she had considered not telling
him, but a relationship with secrets was no relationship at all.
The gene sequencer telling her that the sample had been
successfully analyzed distracted her thoughts. 'No rest for the
wicked' Anne thought as she studied the print out from the
sequencer. She did however allow herself a smile at the results.
The evidence that she was right was now irrefutable.
-- o -- o -- o --
For the next two days Kat, Matthew, Alex, Cathline and John
hoped and prayed as they had never done before. The only
response was another 10% increase in the amount of work the
bio support systems had to do just to keep Elizabeth's body
alive. For Kat this was the final confirmation that she had been
wrong and it hit her hardest of all. Her daughter was dead in all
but a signature on a page. Now came the hardest day of all.
Kat had finished dressing in a dark black dress, and had tied her
long black hair up into a bun. Matthew, John and Alex were
dressed in black suits and dark ties and Cathline too was
wearing a newly purchased long flowing black dress.
All five of them got into a limousine to take them from the hotel
to the hospital. On Matthew's request the media had stayed
away, a gesture for which Kat was grateful. This was a private
moment, a moment when they would flip the switch to end their
daughters life.
Inside the limousine Kat allowed herself to cry and was
immediately comforted by Matthew and Alex. "When the time
comes. I want to do it. I was the one who bought her into the
world so it's fitting I should be the one to take her out of it," Kat
said, choking.
"Ok," Matthew agreed. In a way he was glad Kat wanted to
switch the machines off. It was not a task he had been looking
forward to, and besides, Kat had lived these last few weeks in
denial and this would help her.
"Should we have gone for two more weeks?" Kat sobbed into
Matthew's arms.
Gathering all his courage Matthew drew Kat closer into his
shoulder and stroked her hair. "Kat, my love. You'll always want
two more weeks. We have to let her go," Tears formed in
Matthew's eyes. That was the hardest thing he'd ever have to
say. He so wanted those extra weeks of slender hope, he would
trade his life for those weeks but he knew that it was time to let
go or he might never.
"I know," Kat said, and broke into deep gasping sobs of
tears.
"Mom, We're here for you. For each of us," John said softly. He
hated to see his mother this way.
They sat in silence for the rest of the journey. Each of them
wrapped up in their own thoughts and memories. Dr Atkins and
Dr Roberts, the neuro-consultant met them at the door of the IC
ward and they were then escorted to a side briefing room.
"We've got the papers for you to sign," Dr Atkins said softly.
Inside his heart was breaking as well. This remarkable family
had stuck together for the past six weeks, and now it was time
for their greatest trial of all. Dr Atkins put two copies of the forms
on the table and continued to say, "As Elizabeth's parents you
both have to sign a copy of the forms. I then need to
countersign them as Elizabeth's doctor and then both of them
need to be witnessed by Cathline and Dr Roberts.
Sniffing back tears Matthew said, "Thanks," and took the forms
from the table. He gave one copy to Kat and kept one for
himself. Matthew read the form carefully and flipped the page
over and then re-read it once more. He tried to keep calm and
composed, but before he could sign a deep sob came from his
throat and he had to force it back down again. He took a deep
breath, and signed and dated the form.
For her part Kat had read the form twice as well, studying every
single line of text. She glanced in Matthew's direction and taking
a deep breath, as if steeling herself against a great trial, and
signed her copy of the form. As soon as she had done that she
broke down into an inconsolable mass of tears and sobs.
Matthew immediately moved over to comfort Kat, his face full of
tears. Cathline walked over and placed a hand on Kat's
shoulder. She bent down and whispered in Kat's ear "Kat, it's
time."
Matthew handed the forms back to Dr Atkins for counter
signatures and then had to help Kat to her feet and clutching
onto Matthew she walked into the room where Elizabeth lay.
One by one Cathline, Alex and John filtered in and stood around
the bed. Matthew took hold of Elizabeth's hand and held it to his
chest. Alex took hold of her other hand and kissed it gently.
"Here is the master switch," Dr Atkins said pointing to a large
red switch on the side of one of the machines.
Kat nodded and moved over towards it.
Dr Atkins pointed to another row of switches each colored a red
color "First, you flip these three switches in the order up, down,
up. Count to ten and then flip them down, up, down. You then
have 30 seconds to flip the main switch before it resets again."
Kat turned to Matthew and cried "Mat, I can't do this. I thought I
could but how can I?"
Matthew nodded in sympathy. He felt exactly the same, but it
had to be done. "Kat. I'll do it. She'd want one of us to rather than a
doctor."
Kat tearfully agreed but then changed her mind "We'll both do it.
You do the three and I'll do the last one."
Matthew sighed. "Ok what's the time?"
Dr Atkins checked his watch "It's 13:17".
Matthew slowly walked up to the bio support system and
breathed in. He moved the switches up, down and then up and
counted to ten. He was grateful for the gap, as it allowed him
time to compose himself. Finally he reversed the order and a
voice said "Warning. Shutdown protocols activated."
Matthew moved back to the bed, took hold of Elizabeth hand
and held it tight once more.
Her hand shaking, as if she was pushing against an invisible
wall, Kat's finger rested on the master switch. Images of her
giving birth to Elizabeth, of Elizabeth starting to walk and talk
and then telling her of her engagement to Alex flashed thru Kat's
mind. She nearly pulled back but digging deep into her last
reserves of courage she flipped the master switch down.
There were ten warning bleeps and within a matter of moments
all the monitors went flatline. Elizabeth's chest stopped rising
and falling and a sense of calm descended on the room. Kat
screamed in despair and sadness. At the same time Cathline,
Alex and John cried deep, gasping sobs
Matthew clutched hold of Elizabeth's hand even tighter, bent
down and kissed Elizabeth's face and whispered "Goodbye little
mite," and gently put Elizabeth's arm back down on the bed. He
then joined Kat in weeping for his daughter.
A few minutes later; after waiting for the initial tide of grief to end
Dr Atkins asked "If you'll just sign here Mr Stephens. This is the
formal death certificate. If you don't mind we'll need to take the
body now for organ harvesting. Elizabeth has saved many lives,
it's what she would have wanted."
Kat was still in shock and weeping "I killed her!" over and over
again. John and Cathline were attending to Kat and Alex just
stood over Elizabeth's body in shock. He pressed his finger to
his lips and put it on Elizabeth's head. He took a deep breath
and whispered "Bye Kiddo. Wait for me won't you?" He bent
down and gently kissed Elizabeth's exposed forehead. He then
put his mouth to her ear and whispered, "All of my heart,
forever."
Matthew surveyed the aftermath around him and took the form,
signed it and gave it back to Dr Atkins.
"You mind if I stay with her?" Kat asked.
"We're only taking her down the corridor. You'll see her again
soon," Doctor Atkins said softly.
"I just want one more look at her," Kat sobbed.
Matthew took hold of Kat's arm in comfort. "Kat, my love, you'll
always want one more look. Let her go."
Deep down Kat knew Matthew was right, Elizabeth was gone.
-- o -- o -- o --
In her dorm in Tel-Aviv Anne checked her watch as the time
flipped over to 16:18. From the news reports she had read
Matthew and Kat had just switched off Elizabeth's life support.
She so desperately wanted to be there. but knew that she would
give herself away by the emotion she would be unable to
contain within herself.
She had wished a lot of things on Matthew and Kat over the
years but not what they had just been thru. That thought gave
her a glimmer of hope. Deianeria had shown no remorse at what
she had fantasized about raping and murdering her own family,
whereas she at the height of her fury had fallen short of that
horrific act. Deianeria took sexual pleasure from killing whereas
she had only killed when needed. It was a fine line but one that
gave her a slender thread of comfort.
Anne tried to get back to some work but her thoughts kept
wandering to the IC ward in that English hospital. She knew
what was going on but she so wanted to be there it hurt. To try
and take her mind of events, she turned back to her PDA and
started the final read thru of her paper.
-- o -- o -- o --
Mark's PDA bleeped a few times, which had the effect of waking
him up from his sleep. Wearily he got out of bed and walked to
the table where the PDA was still beeping away. "What now," he
muttered.
"PDA read mail message to me please," Mark said sleepily. It
was too late now. He was up and awake, and no amount of
counting sheep would rectify that. This had better be good.
The PDA read. "To Mark.Andrews@Haverford.edu. From
immigration@israel.nation
Dear Mr Andrews. You request for a travel visa has been
approved. Please note that future travel to restricted countries
may revoke this Visa or lead to deportation from Israel. We hope
you will enjoy your stay."
Mark shouted, "YES!" He was now only a few days away from
meeting Anne again. He just hoped she'd still be there when he
arrived. His first reaction was to call Wills and tell him but then
he remembered that it was still first thing in the morning. Instead he
readied himself by sending his newly acquired visa number to
the airline to finally confirm his place on the flight. It would take a
while to get confirmation thru so in the meantime he walked into
his kitchen, hunted around for a clean cup, and started to make
himself a cup of strong coffee.
-- o -- o -- o --
Hand in hand Matthew and Kat walked down the long corridor of
St Luke's hospital as they had done every day for the past six
weeks. Every step was an effort, but in a way they both felt relief
from the ongoing torment of waiting and hoping to no avail. Now
at least there was an end and they could begin to rebuild their
shattered lives. Later on that day they would hold a press
conference, and Matthew admitted that he wished he'd never
arranged it. But people had to be thanked for their support and
grief made public. It would help all of them come to terms with
what had just happened. Cathline, Alex and John had gone on
ahead while they stayed behind to sort the remaining legal
details out. Elizabeth's official time of death was 13:18GMT,
which was just as Kat wanted it to be.
Another thing that brought them a little comfort was the fact that
Elizabeth had had her family with her when she had died. It
would have been so much worse for them had she died alone
and terrified in that farmhouse a few weeks back. True it was
small comfort, but at this time they took any that they could. In a
few hours time Elizabeth's body would be taken to the local
funeral directors for preparation and from there be flown to their
island in the Maldives for burial.
They met the rest of the family at the hospital reception desk.
Alex was sitting down on a nearby chair and was being
comforted by Cathline. John was sitting next to them, staring
into space in shock. There was no smile from Cathline as she
saw Matthew and Kat walk in, just a simple nod of the head as if
to say 'Is everything sorted out?'
"We just want to wait and thank Dr Atkins and the rest of the
staff who looked after Elizabeth," Kat said softly.
"We know. We were told they'd be out in a few minutes and let
us know how many lives Elizabeth would save," John said as
stoically as he could muster.
"Anyone want a coffee?" Matthew asked. He just needed a short
break away to compose himself some more.
There were various orders thrown at Matthew, and in his
shocked state he had trouble remembering them. After another
slower repetition of the order, he went off in search of a vending
machine.
It took Matthew a few minutes to find an old looking vending
machine, but at least it was still working. He fumbled in his
pockets for some change with which to buy the drinks. Carefully
reciting the orders he primed the machine with change and the
machine proceeded to pour the alleged coffee into small plastic
cups. He used the last few euro-cents to buy a small disposable
tray and walked back to the reception.
He knew something wasn't quite right when he heard excited
voices from where Kat and the others had been. Dr Atkins and
other medical staff were surrounding Kat and were looking to be
explaining something. He caught a glimpse of Kat's face. She
was smiling for the first time in weeks!
Matthew rushed over as best he could to see that the
commotion was. He quickly put the tray of drinks onto the
receptionist's counter, and pushed his way thru to be alongside
a joyous Kat. "Kat, what's going on?
"A miracle!" Kat said and gave Matthew a large hug.
Matthew returned the hug but was still confused. "Kat, please
tell me."
"Elizabeth's started breathing again!" Kat exclaimed, and gave
Matthew a large kiss.
"How?" Matthew exclaimed and returned Kat's kiss.
"That's what Dr Atkins was trying to explain when you walked in,"
Cathline replied.
Dr Atkins shrugged his shoulders "Ok, for Mr Stephen's benefit
I'll start again. As you know we took Elizabeth's body down to
remove the organs for transplant. We were just about to make
the first incision, when a colleague noticed her chest gently
moving up and down. We immediately took pulse and
respiration measurements and although not normal were
slowing rising. Straight away we put her on a ventilator to help
her out but she didn't seem to need it. Now she's gone in for
some tests to see the extent if any of brain damage and to find
out what the real picture is. I can't explain this at all."
"How long before we know?" John asked.
Dr Atkins checked his watch, "The brain scans will take about
an hour, the internal ones should be done in the next few
minutes."
"So is she going to wake up?" Alex asked hurriedly.
"From the initial results I don't see why not. But there could be
significant brain damage. The only thing I can tell you is that she is
breathing normally and on her own."
"When can we see her?" Matthew asked. The turn around in
events still had him stunned and overjoyed.
Dr Aktins thought for a few moments, "Soon. You know where
the briefing room is. I suggest you go, take your drinks and wait
until we have some news for you."
"Deal!" Kat broke into a smile and shook Dr Atkin's hand.
When they were in the privacy of the briefing room Kat allowed
herself a few tears of joy. She KNEW Elizabeth was still alive!
Somehow, deep down in herself she had known. "She's alive
Matthew. I don't know how come, but thank God she is!"
A multi-way conversation ensued with everyone exclaiming their
joy, but puzzlement as to the reason for the sudden upturn in
Elizabeth. About an hour later Dr Atkins and a neuro-consultant
walked in. Matthew noticed that Dr Atkins was holding a large
brown envelope under his arm. "What's the news?" Alex said
excitedly.
Dr Atkins took two large photographs from the envelope and
placed them on a nearby table. "To say I am stunned is an
understatement. From the scans we took earlier on today it
looks as though Elizabeth's lungs and heart have completely
healed themselves, and there is no sign of internal scarring or
bleeding. She still has a smashed rib but that's not life
threatening."
"And brain damage?" Kat asked hesitantly.
"This is the confusing part. I'll hand you over to Dr Renton here
who will try and explain," Dr Atkins indicated to the neuro-
consultant who nodded in recognition.
"Ok, this plate here is of the brain scan we took when Elizabeth
was first brought in," Dr Renton said indicating to the left hand
side photograph, "If you notice this small dark area here. This is
some kind of disorder, but we can't be sure without further
study."
Kat knew what it was. She'd seen that mark a number of times
before. But she didn't say anything.
"Now on this plate," Dr Renton pointed to the right hand
photograph. "There is no mark at all. Whatever disorder had
been in place is no longer there!"
Matthew was staggered. "Are you telling me that somehow
Elizabeth's body has repaired it's self and cured this brain
disorder?"
Dr Renton nodded, "That's what I'm telling you. My best guess
is that her body was using everything it could to repair the
damage, and that's why she needed the bio support systems
more and more. I'm aware of her unusual origins. Is it possible
Dr Bexley gave her some kind of enhanced healing ability when
she created her? That's the only reason I can think of because
as it stands that's the only way this was possible."
"I've no idea what Dr Bexley did to her before she implanted her
in me. Whatever it was we all owe her one," Kat said softly.
"So when will she wake up?" Alex asked again.
"She's sleeping peacefully now. Her body has gone thru
massive trauma, but she'll be fine. She's still in a side ward on
her own so you'll have some privacy. Because she's had no
activity for a number of weeks she'll need to gradually build her
strength up before we can move her. Good job she looked after
herself as this has helped her enormously."
"Is she off the machines?" John asked.
Dr Atkins looked at a concerned John and said "She's still
connected but that's purely precautionary. If all goes well we'll
disconnect her tomorrow."
"Can we see her?" Matthew asked excitedly.
"Sure, Now we've finished the tests. Try not to wake her just yet
though, so it'll have to be one at a time." Dr Atkins replied.
"Me first," Kat demanded.
-- o -- o -- o --
The next morning it was Alex's turn to see Elizabeth. The
previous afternoon they had all quietly filtered in one at a time
and paid their respects to the now sleeping Elizabeth. Her
deathly gray pallor at had gone, and although she looked far
from her normal glowing self she was definitely better than she
had been for some time. The get well feelings they shared
with Elizabeth were muted, as they dare not wake her. Alex had
been dying to give Elizabeth a hug, but had to hold back. As he
walked into the side room he noticed with great relief that she
had been disconnected from the bio support systems, and that
for the first time a plastic breather mask didn't cover her face,
and that she was breathing freely.
Alex sat down on the chair next to Elizabeth. He'd just met
Matthew on his way out and he'd told her that Elizabeth was still
fast asleep. Alex adjusted his chair and leaned forward. "Well
Kiddo you always wanted to get one up on me, and I must admit
you've got me beat this time. You had me going for a while
there," he whispered, not wanting to wake Elizabeth.
From the corner of his eye he noticed a slight movement of
Elizabeth's arm. It seemed to be more of a twitch than a
conscious effort but it was the first time Elizabeth had moved in
over six weeks. "Elizabeth?" Alex asked. His voice was full of
hope.
There was no reply but Elizabeth's muscle's on her face
twitched.
"Hey kiddo," Alex queried. He tried his best not to let his
euphoria overwhelm Elizabeth.
A quiet, almost silent whisper replied, "I told you not to call me
Kiddo."
Alex leapt up and gave Elizabeth a hug. "I missed you!"
To Alex's dismay and puzzlement Elizabeth turned away from
him. "No Alex please, Where am I?" she asked.
"Hospital. You were shot!" Alex explained. He saw to his relief
that Elizabeth had opened her eyes and was now starting to
focus on the room around her. How he'd missed her blue-gray
eyes, sparkling full of life and intelligence. He'd have swapped
his own life just to look at them again and now they were looking
at him in deep regret and sadness. But why?
"Shot?"
"Shhh, rest," Alex said and tried to kiss Elizabeth but again she
moved away.
"No Alex. It wouldn't be right. Where's Mom and Dad?"
'Wouldn't be right?' What the hell was Elizabeth talking about?
Alex decided against his feelings that it was better to let it drop.
"They'll be here soon. I'll call and tell them you're awake. I'll go if
you want me to," Alex said. He didn't want to leave, but
Elizabeth looked so tired.
"Tell them I love them. Alex, please go and be with them. I'm so
tired." With that the blue-gray eyes closed as if closing the
conversation.
Alex was upset. His initial joy and jubilation had evaporated as
quickly as it had arose. Why had Elizabeth been so cold towards
him? Didn't she love him anymore? These were questions he'd
need the answers to quickly, but only when Elizabeth was ready
to talk. In the meantime Alex stood up and once he was outside
the hospital called Cathline on his PDA.
Alex only had to wait a few minutes and soon spotted Cathline,
John, Kat and Matthew walking from the hospital car lot. He ran
towards them and shared what had happened with them. In all
of this Cathline was unusually subdued, but Alex put it down to
a mixture of exhaustion and relief.
"So she's gone back to sleep?" Kat asked.
"Yeah. Look why don't we go to hospital restaurant for a coffee?
We'll give her an hour or so before we look in again. It was odd
but she doesn't remember being shot!" Alex replied.
Cathline reminded Alex, "She's still in shock. She may be awake,
but she's not better."
"I guess."
-- o -- o -- o --
After spending two hours drinking tasteless and tepid coffee
they decided it was time to see how Elizabeth was. Alex was
relieved to see Elizabeth awake and sitting up in her bed. On
seeing Matthew and Kat, Elizabeth broke into a huge smile and
whispered "Mom, Dad, John, Auntie Cathline!"
Kat struggled to fight back her tears of joy and she towards
Elizabeth and gave her a hug. Elizabeth returned it, albeit
weaker. "Mom you came!"
"Try keeping me away. Elizabeth you gave us such a scare. Are
you ok?" Kat asked. She felt the tears start to form again but
blinked them back.
"Just A little tired, that's all. What happened to me?" Alex told
me I was shot but I don't remember it at all."
"It's ok. it'll come back," Kat comforted Elizabeth.
Elizabeth's face dropped a little when she looked at Alex, "Alex
would you mind finding a nurse for me. I could do with some
more water. Actually an OJ would be better."
Glad to be noticed Alex perked up, "Sure."
Elizabeth waited until Alex had left the room. She reached over
to her left hand and with a little tugging removed her
engagement ring. She carefully placed it on the tray in front of
her. "When Alex gets back I want you to give this to him."
Cathline was shocked. She glanced around at the others and
they were just as shocked as she was. Kat even more so.
"Why?" Kat stammered.
"I think you know why. All of you do!" Elizabeth sneered.
Kat looked at Elizabeth with concern, "Honestly we don't! When
we last saw you, you couldn't wait to get married! What's
changed? We don't mind if you have changed your mind. It's
much better that you do this now if you have to, but we're just
staggered that you'd call it off. Alex was there with you for fifteen
or twenty hours at a stretch. He adores you Elizabeth."
"I know and that's what makes it so hard. But I can't marry him,
not now, not ever!" Tears formed in Elizabeth's eyes.
"Why? Cathline asked.
Elizabeth shot Cathline a murderous stare, "You know why, don't
you! Angela was the one who was holding me hostage. She told
me everything!"
"We know about Angela, she's dead. You shot her when trying
to escape," Matthew stated softly. Why was Elizabeth doing this
to herself and Alex? Matthew knew she loved Alex dearly so
why was she ending it?
Elizabeth looked puzzled, "I didn't shoot anyone, and how could
I escape? I was tied to a chair! Anyway I'm not letting you off the
hook. Cathline you KNEW about this but didn't tell me WHY?"
Elizabeth voice was deadly serious.
Cathline went as white as a sheet. All the color drained from her
face and she wished the ground would open up and swallow
her.
"What the hell are you talking about?" Matthew demanded,
"Cathline what's she talking about?"
Elizabeth's eyes narrowed and she glared at Cathline in fury.
"You never told them did you? I'm surprised they never
guessed, but its not the kind of question that you'd ask is it?"
"Cathline, What the hell is she talking about?" Kat demanded.
Cathline said nothing but her face was like stone.
Elizabeth once again gave Cathline a hard look. A look of
betrayal and heartbreak "The reason why I can't marry Alex, no
matter how much I love him is because he's my half brother!"
There was a crash from the doorway. Alex had just dropped the
glass of OJ he'd got for Elizabeth.
Alex was more than stunned. Half brother? Not Marry him?
What in hell was Elizabeth talking about? He felt as if he'd just
had his heart ripped out. All he managed to say is "What?"
Cathline turned away from Elizabeth and the rest of them. Inside
she felt an awful combination of guilt and despair. She sighed
deeply before turning around to face Elizabeth once more. This
was going to be hard. "She's right, in a way. Kat, you're Alex's
father."
"Huh?" John said.
Alex's face turned to stone. How was this possible? He'd been
told that his father was killed in the Guild war, that he had been
conceived when Cathline was in Osman's dungeon. What the
fuck was going on?
Cathline sat down on the nearby chair and took a deep breath.
This was going to take some explaining, "Kat you remember
when you were in Salah's body?"
Kat nodded, "How could I forget? Uck, all hairy and square and
as for having a dick, well don't get me started on that one!" Kat
was feeling deeply confused, even hurt, and was using humor to
try and hide her feelings.
"Stop trying to use humor to get around things mom," Elizabeth
whispered. Already she was feeling exhausted, but she needed
to get this out in the open.
Kat whirled around and snapped at Elizabeth "Hey!"
Cathline looked up at her stunned friends and then turned to an
angry looking Alex "Alex what I told you was true, to a point. The
real Salah was killed in the Guild war. You are his son. You
share his DNA, his noble spirit and everything that made him
unique. I was imprisoned in Osman's dungeon and Kat came to
me in as Salah and was forced to make love to me. Alex, you
were conceived then."
"Why didn't you tell us?" Matthew demanded. How in hell had
Cathline kept this quiet?
Cathline knew she was in for a hard time and immediately went
on the offensive, "Because in reality Alex isn't Kat's son. Sure
she performed the act, but it's not her DNA, not her essence
that Alex shares and has. Alex is no more her son than
Elizabeth is her biological daughter! Alex is MY son. I had the
pain of bringing him into the world. I fed him and raised him to
be the wonderful young man he is now. Kat, you made love to
me and you know what? I still cling to that moment. Kat, it's one
of the most precious times I ever had. It didn't seem it at the
time, but a new wonderful life came from it! I didn't tell you at
first because I simply didn't know I was pregnant. It wasn't until I
started to show that I suspected anything. My body was so
messed up with all the stress of the whole Fury thing that I'd
missed a few months before anyway. "
"Why didn't you tell me later on?" Kat asked. Alex nodded. He
was going to ask the same thing.
"Because I didn't and that's that! I wanted Alex for myself. Yes it
was as selfish as hell, but I didn't want to share him. He's the
only bit of light I have in my life, other than you guys. When I
see him I see what I could have had with John and that makes
me selfish. Kat what would you have done if I'd have told you?"
Kat was still in shock from the whole thing "Dunno. I'm still trying
to get my head around it. I'd have probably have wanted to help
out in bringing him up."
Cathline was still on the offensive "Which you did anyway, just
as I did Elizabeth! Alex I'm sorry I didn't tell you the complete
truth, but what would you have done if you had known?"
Alex was too upset to make much sense. He had searched for
months for his father, and his mother had sat there and let him
do it. He had poured his heart and his soul into the search, and
its negative result had been devastating to him "My search. You
sat there and let me look for my father, and all the while he was
Kat?" Another realization hit him "That's why Elizabeth can't
marry me. We're brother and sister!"
"Whose son am I?" John asked. He was trying to lighten the
tone. The last thing his sister needed was a full on row.
Kat shot John a 'shut it' look and proceeded "But you're not
Elizabeth's half brother, are you Alex? Elizabeth is Dr Bexley's
daughter not mine. Matthew and I are adoptive parents not the
biological ones."
"What about the law?" Matthew asked.
"Fuck the law. I love Elizabeth. She's only just come back to us,
and here we are bitching about what's past. Kat you were a
wonderful 'father' to me. Mom what you did was selfish and it's
going to take me a while to forgive you for it. I still don't
understand why you kept this a secret and I hope it's for a damn
good reason. But Elizabeth is the main priority here. Let's
redraw the family tree when she's better!" Alex snapped.
Kat felt guilty for dragging this out. Alex was right. Elizabeth was
the top priority. "I'm sorry. It's just a shock that's all."
"Can I speak to Alex alone?" Elizabeth asked quietly.
Cathline ignored Elizabeth's request. She still wanted to justify
her actions to the rest of them, and hadn't heard Elizabeth's voice.
"Maybe I should have told you."
"Damn right!" Matthew exclaimed.
Cathline took a deep breath and continued. This was getting
very ugly very quickly, "But I had some good reasons at the
time. This all happened twenty years ago, and after Alex was
born, well it just didn't seem right to disrupt and jeopardize our
friendship over it. I love you guys more than anything. You are
my family and I didn't want to risk that."
"You underestimate how we feel about you Cathline, if you
thought that. Hell, we've gone thru worse than this and still
come out friends," Kat said softly.
Cathline put her head down, so her long blonde hair covered
her face. She felt so ashamed of what she had done and what
she was putting her best friends thru, "Kat, I'm sorry. What else
can I say? Alex, I'm even more sorry. I should have told you but
I thought, in my insecurity and loneliness, keeping this a secret
was the best way of still keeping you all as friends."
Cathline started to cry. "Kat, I'm so lonely it hurts. It's ironic isn't
it? I'm the most beautiful fifty year old on the planet, and yet I'm
alone. John was my soul mate and he's dead! I didn't know
what I had in him, did I? So I played around with Dr Bexley,
convinced myself that I was in love with her because, in my
mind, maybe John wasn't the one. Then when John was killed I
latched onto Kat, because as a friend she IS my soul mate, but
you're so in love with Matthew I never stood a chance."
Cathline paused and wiped away a tear from her eye, "I told
myself that I'd wait for John. That, because of what I did to him I
owed it to him to wait until I met him again. But it's so hard. I
know I was wrong to hide things away from you, but I hope you
can understand that I was too fearful to risk throwing away my
last remaining family."
Kat walked over and gave Cathline a hug, "Oh you silly thing.
We ARE family. You, John, Alex, Elizabeth, Matthew, and me
are all in the same family. Sure we're not all related by blood,
but family is more than just flesh and blood. Family is
relationship, trust, giving of yourself and expecting nothing back
in return. That and a whole lot more as well! There's no need to
feel lonely Cathline, we're here for you."
Cathline put her hand on Kat's "You always did know how to
sort me out didn't you?"
Kat smiled, "Friends?"
Cathline smiled and rested her head on Kat's arm, "Soul mates."
"Sorry to break this up. But I really need to speak to Alex,"
Elizabeth stated. She was glad that the initial rift had been
healed but she also knew that there was a long way to go. But
as Kat had so eloquently remarked, they were family, and true
families endured the most savage of storms.
"Come on guys. Alex was right, Elizabeth needs her rest and
we're just in the way," John said. He admitted to himself that he
was a little overwhelmed by the news that had just been
announced, but he knew that he had to stand with his parents
and Cathline in this. They would work it out, they always did.
This one would take a little time to resolve but the first tentative
steps towards healing had been taken.
"Come on 'soul mate'," Kat said to Cathline with a smile, and
helped Cathline to her feet.
Cathline gave a smile and the group walked out, leaving Alex
and Elizabeth by themselves.
-- o -- o -- o --
Alex walked over to where Cathline had been sitting, sighed
deeply and asked, "You look exhausted. Want me to come
back?"
"It's ok," Elizabeth said quietly.
"What did they do to you?" Alex asked quietly.
Elizabeth thought back to the horrific revelations that Angela
had assaulted her with. "Do you hate who I am?"
"Pardon?" Alex asked.
"Angela, she told the world who I was didn't she?" Elizabeth
said quietly.
Alex nodded, "Somebody did. BUT it doesn't matter. That's old
news now. You being in that coma spared you of the full
spotlight of the media. You didn't hear what I said to you the first
day I found out, did you?"
"What was that?" Elizabeth asked. Had Angela been right? Was
any chance of a normal life over and done with? Alex was right
about one thing. Being in a coma had spared her an
enormous amount of hurt and questions from the media. Sure,
the subject would come up again, but the initial sting had been
removed.
"Umm let me think," Alex said. The memory of pouring his
heart out to an almost dead Elizabeth was still fresh in his mind.
But now he had had the biggest shock of all. She no longer
wanted to be his wife. He had really thought their love was
stronger than that. He had poured out so much to her
over the past six weeks that it had all merged into one. Then it
came to him "I think it went something like this
'I don't know if you can feel this ring still on your finger but it's a
sign of our love for each other. It tells the world we are meant to
be. I don't care whose cells you came from or what DNA you
have, I just want you back with me. Kat and Matthew showed me
and you that love can cross any boundaries, outlast the fiercest
fury and endure the greatest pain.'"
Elizabeth was silent. Deep down she still loved him but no
matter her feelings for him -- Alex was still her half brother. They
shared the same parent. "Do you still feel like that?" she asked.
Alex looked into Elizabeth's blue-gray eyes. He felt more in love
with her than ever, so why didn't she love him any more? "More
than ever, especially now. Elizabeth I'm still confused. Why don't
you tell me what happened from the start. If you are still up to it
that is. The police will be here in a few hours to take a statement
so it'll help you if you tell me."
Elizabeth shuffled herself in the bed, trying to get comfortable.
Alex got up and helped her adjust her pillows. Once Alex had
sat back down again Elizabeth started to explain.
"I remember walking into my dorm and finding the lights out and
not working. I found Angela lying on the floor and called to my
PDA to activate the alarm but it didn't work. I felt myself being
grabbed from behind and then it all went black. I've no idea how
long I was out for but it must have been several hours. I awoke
in a room and after a short while I saw a figure walk out from the
shadows. Alex, it was Angela. She betrayed me! She was a
plant all along. Everything she did, her friendship with me was
all a sham."
Alex looked puzzled "For what reason?"
"So that the Children of Bexley could force me to become Dr
Bexley," Elizabeth said softly. The torrent of hate, fury and
emotion she had felt when Angela was betraying everything she
had held dear was still very vivid in her memory.
Alex thought for a few moments, "Because you had the same
flaw in your brain as Dr Bexley had? They wanted to get you so
angry and upset that it would provoke that flaw."
Elizabeth nodded, "Angela had switched my medicine around
and made it impossible for me to take any more. Alex it's not
just that you are my half brother that I can't marry you, it's
because I'm afraid of what I might do to you!"
Alex thought back to the scan's he was shown "Don't be.
Somehow the flaw or whatever you call it is gone. We were
shown two scans before and after. The after shows no flaw."
Elizabeth's face screwed up with confusion. "How is that
possible?"
Alex shrugged. "The doctors said Dr Bexley might have
enhanced your healing ability. Anyway, what in hell did Angela
tell you?"
Tears formed in Elizabeth's eye, "Everything. She pulled my life
to shreds, methodically and without remorse. She told me how
she'd been trained to do this to me from an early age, forged
some entries from Dr Bexley's diaries, and planted evidence
that would seek to confuse me. Alex I did a terrible thing!"
"What's that?" Alex asked cautiously.
"You remember, I was looking into what really happened to Mom
and Dad all those years ago?" Elizabeth said.
"Yeah and I told you not to bother," Alex said.
"I wish I'd have taken that advice. You told me it would lead to
fire and pain. How right you were! In my mind I created a
simulated Dr Bexley. She would be Dr Bexley in thought, mind,
and deed. I gave her a name."
"Deianeria? I thought that was just the name of the project?"
Alex asked.
Elizabeth nodded, "She was more than a project. She was part
of me, an alternative personality. That's why I kept wearing Dr
Bexley's old clothes. I was slowly becoming my image of Dr
Bexley. One thing I do know is that Deianeria was utterly evil.
Even more so than Dr Bexley ever was. The only word I could
use to describe her is demonic. I'm not saying it was
supernatural or anything like that, but sometimes when she had
returned control to me I would come back into my own mind and
feel very aroused as though I'd just had an orgasm. Then
afterwards I'd get nightmares of people I loved slowly dying in
awful pain and terror. I somehow knew Deianeria would do
those things, given the chance. She was so evil Alex. More evil
than anything I have ever seen before or since!"
Alex took hold of Elizabeth's hand for a moment and managed
to say "Hey, it's ok it's over now," before Elizabeth withdrew it.
Elizabeth gave a wan smile and continued, "When Angela was
doing this to me I could feel Deianeria slowly forcing her way
into my conscious mind. With each revelation it got stronger and
stronger until she finally swamped me. Angela's last revelation
was about you, and how my family had deceived me. I hung on
as long as I could, but Deianeria was too strong. The last thing I
remember was Deianeria laughing as she took over my mind.
Then I woke up here. I've no idea who shot me. Angela didn't
even have a gun. Maybe Deianeria tried to escape and forced
Angela into shooting me?"
Alex looked worried, "Where is Deianeria now?"
Elizabeth shrugged. "No idea. It's as though she died when I
did. She's not in my mind anymore. Oh! I've just had a thought."
"Which is?" Alex asked.
"If Deianeria is gone and my flaw is cured then she can't come
back. Alex I'm safe!" the relief was evident in her voice. She felt
as though a weight had finally been lifted off her. She finally felt
free. For six years she had lived with the specter of Dr Bexley,
and now it had been exorcised for good. She was a normal
person again, maybe even for the first time ever! She had no
reason to be afraid anymore. Elizabeth burst out laughing with
joy, "Alex I'm free of her. Don't you see? If she's gone and I'm
cured then I'm free. Alex this is so wonderful!"
Alex wanted to hug Elizabeth but held back, Elizabeth had been
politely pushing him away since she'd woken up. Instead he
gave a broad grin "Kiddo, that's wonderful."
Elizabeth's smile faded, "Alex I love you more deeply than I can
say but how can we be married? Even if we tried to the law
prevents us."
"Who's to know?" Alex asked.
Elizabeth turned her face away from Alex, trying to hide the
tears that were forming, "I would. I can't marry you Alex. It's
sick. Brother and sisters can't and shouldn't marry."
"I know. I'm still trying to get my head around it. Let me see if
I've got this right. Ok, Dr Bexley cloned herself, and added a few
'enhancements' and put the fertilized egg inside Kat. Correct?"
Elizabeth nodded, "Yep"
"So you are not related by blood to Matthew, Kat and John? Kat
was your surrogate mother. Dr Bexley could have put you into
anyone but chose Kat right?"
"That's the way I see it," Elizabeth stated.
"Now when Kat had been turned into Salah she was forced to
make love to mom right? From that act I was conceived and
mom didn't notice for a few months."
"That's what she said," Elizabeth agreed. She could see where
this was leading and allowed herself a flicker of hope.
Alex tried to clarify things further. He found it helped him come
to terms with what had just gone on. "So when Kat was turned
back to her 'Jasmine' body then she was no longer related to me
by blood. Mom fearing she'd alienate herself from Matthew and
Kat etc didn't tell anyone and made up a story about another
Guild agent screwing her."
"Yep." Elizabeth's glimmer of hope turned into a ray of light that
was starting to wipe away her doubts.
"If you aren't related to Kat, except by adoption and I'm not
related to Kat by blood then how in hell can we be brother and
sister? We're not even half brother and sisters. Can't you see it?
The Children of Bexley were wrong! The last thing they told you
was a lie designed to release this Deianeria in you and so
create their 'Dr Bexley'."
Elizabeth gave a whoop of joy, "Of course! They didn't believe in
DNA modification. So how could Kat be your dad? Because if he
were then Kat's DNA would need to have been modified to
make it happen in the first place! The only way to explain it
would be if DNA modification were possible, which they said
couldn't be done! I was in such a confused and angry state that I
didn't notice the lie buried in the truth. The bastards knew it was
a lie!"
Alex nodded "Very clever of them wasn't it? I bet you made their
day when you agreed to marry me. That was the key they were
looking for."
Elizabeth studied Alex's face. He looked so tired and sad. The
clown was gone, and in his place was someone who had gone
thru fire and pain "They were exceptional at deception. Alex
you're right. We're not brother and sister. I can't tell you at how
much better this makes me feel. "
Alex had a thought, "I'm so happy for you, for us! You know Dr
Bexley saved you. Maybe not directly, but her changing you to
have this enhanced healing ability saved your life. She gave you
every chance she could to live. I think she wanted you to
succeed her, be better than her and not to make the same
mistakes as she did."
Elizabeth suddenly started crying. The tears were of release and
healing rather than of sadness, "Alex you're right! It seems as
though all my life I've lived in fear and in denial of who I am. I'm
proud to be Dr Bexley's daughter. When people throw that at me
as an insult I'll take it as a compliment. I was subjected to more
emotional pain than Dr Bexley ever was, and yet, thanks to her
and my family I've survived intact and alive! I will do better than
she did! She was an exceptional surgeon and doctor and I'll be
even better! That's how I'll repay her. That and this!" Elizabeth
reached over to the tray across the bed, picked up her
engagement ring and placed it back on her finger.
On seeing Elizabeth put the ring back on Alex stood up and
gave Elizabeth a passionate kiss. To his joy she returned it and
his spirit soared. They were together again, as they should be,
as they were destined to be. He pulled away and said "I'd better
go and tell Mom and Dad the wedding's back on, and you Kiddo
need to rest."
Elizabeth glanced down at her engagement ring and gave Alex
a smile, "Don't call me Kiddo."
-- o -- o -- o --
A day or so later Mark's plane touched down at Tel-Aviv airport
and he emerged to scorching hot sun. He'd only taken a single
large bag with him, as his ticket was a restricted three day
return. He had three days to find Anne before he had to return
to the US. His first port of call was a small hotel just near the
university campus. Not only was it cheap, it was an excellent
base from which to try and find Anne. Pushing his baggage cart
he hailed a cab, told the cab driver the address, laid back, and
tried to unwind. He would have a shower, change and then after
a bite to eat go find Anne. Inside he felt empty and lost. A
number of times he'd spotted a head of long blonde hair and
thought it might have been Anne, but on further investigation it
proved not to be. Feeling thoroughly miserable he put his
earpiece in his ear and selected a track of music from his PDA.
He'd been listening to some of Anne's taste in music. It had
helped him feel a little closer to her somehow. Thinking back to
his trip from the airport and how he had felt these past few
weeks he had just the track in mind, "PDA play track 18
personal collection," Mark adjusted the volume in his PDA and
listened to the old rock ballad
'Loneliness is your only friend.
A broken heart that just won't mend, is the price you pay.
It's hard to take when love grows old.
The days are long and the nights turn cold, when it fades
away.
You hope that she will change her mind, but the days drift
on and on. You'll never know the reason why she's gone.
Empty rooms, where we learn to live without love.
Empty rooms, where we learn to live without love.
Empty rooms, where we learn to live without love.
You see her face in every crowd.
You hear her voice, but you're still proud, so you turn
away.
You tell yourself that you'll be strong.
But your heart tells you, this time you're wrong.
Empty rooms, where we learn to live without love.
Empty rooms, where we learn to live without love.
Empty rooms, where we learn to live without love. '
Mark looked outside at the bustling city around him. Would Anne
have him back? He didn't know, but he had to try, otherwise his
life would be full of ifs and maybes. He closed his eyes and
listened to the end of a long guitar riff.
'You hope that she will change her mind, but the days
drift on and on. You'll never know the reason why she's
gone.
Empty rooms, where we learn to live without love.
Empty rooms, where we learn to live without love.
Empty rooms, where we learn to live without love.
Empty rooms, where we learn to live without love.'
The cab drew up alongside an old looking hotel. It looked as
though it had survived the fires that had ravaged much of Tel-
Aviv He took his bag out from the cab, paid the driver and
walked inside.
The polite way to describe the hotel was basic. It didn't have
voice activated lighting or even air conditioning, but it did have a
bed and an almost clean shower. Mark washed a few hairs from
a previous user down the drain and proceeded to unpack.
His most disturbing discovery was a small puddle shaped stain
on the green carpet. It looked as though it had been washed
several times, but the stain was still visible in broad daylight.
Mark knew what the stain was. It could only be one thing. It was
the remains of someone who had been killed during the Guild
attack twenty odd years ago. Mark didn't want to think about it,
so he put his bag over the stain. At least he wouldn't have to
look at it everytime he walked in. Mark stripped off, ran the
shower for a few seconds until he'd got the right temperature
and stepped inside.
An hour or so later a freshly groomed Mark stepped out of the
hotel and hunted for the cheapest place to eat he could find.
Even with Wills's money this trip would stretch his finances to
the limit. He eventually found a McDonalds-King which was
about his financial limit and sat down for a Big McKing and fries.
After one bite he knew he could still be in Haverford. They all
tasted the same wherever you went. He checked his watch. It
was 17:00 local time so if Anne was anywhere she would be
about to leave the lab. He fished out his PDA, now was the time
to try out his new Israeli GPS guidance module. More expensive
models of PDA had a global version built in, but he'd spent 200
bucks on this. It would save him time in trying to find his way
around Tel-Aviv. "PDA take me to the Life sciences faculty Tel-
Aviv University."
The PDA's screen lit up and a small arrow pointed straight on. A
small distance reading showed in the top right. It was 1201
meters away. Cramming his mouth with the remaining part of his
burger he set off, following the directions of his PDA.
It took him ten minutes to walk to the right building and strangely
there were few students around. Still, he stuffed his PDA in his
pocket and went inside. The inside of the faculty was much like
the one back at Haverford, but the bright late afternoon sun
made it seem much brighter than the halogen lit interior he was
used to.
Eventually he found a notice board and was studying it, trying to
find a class or a room where Anne might be found. Somebody
tapped him on the shoulder, which had the effect of making him
jump out of skin. A tall but elderly man stood in front of him. The
man's bright but intelligent looking eyes studied Mark for a few
seconds before the man asked, "Can I help you?" The man had
a heavy Israeli accent and it took a few seconds for Mark to
understand it.
Mark composed himself and said, "I'm a close friend of an
American student called Anne Baxter. I'm trying to find her, do
you know where she is?"
The man looked at Mark and weighed him up. Deciding he
looked ok the man took out his PDA, and spoke to it in Hebrew.
Mark waited a few moments, hoping that the man would tell him
where Anne was.
The man gave Mark another look and said "She's out with the
research ship 'Easu' She'll be back in two days. Have you tried
mailing her?"
"Yes I have. Where's she due to dock?" Mark asked. He tried to
contain his excitement. Anne was here!
The man consulted his PDA, "The 'Esau' is due to dock at Bat
Yam harbor at 10:30am"
To the man's surprise Mark shook his hand, and thanked him.
Mark ran out of the building. Two days was nothing, he would be
there waiting for her when she came back. He just hoped his
money lasted that long. It would be a close call but he hoped he
had enough time to win her back before he had to fly out.
-- o -- o -- o --
Anne sat on a deckchair, on the stern of the research ship
'Easu'. It felt good to be back on the ocean again. She'd missed
the freedom these last few months and although the 'Esau' still
had no re-breathers, it didn't matter, she could dive and that was
enough for her to start to relax. She'd just finished the final proof
read and now, finally her paper was complete, the evidence and
proof were safely stored in a lab on campus. Even if that were
destroyed, she still had documentation that proved she was
right. Anne reached down, picked up a glass full of cold orange
juice, and looked out to sea. The sun was starting to set and
tonight they would be heading back to Tel-Aviv. She would wait
until she had access to a secure land based portal before
sending her paper in. That way she would have an audit trail
proving she had written and sent it.
As she watched the bright orange sun cast rippling flames of
light over the surface of the sea she wondered how Elizabeth
was doing. Either her plan had worked or she was dead. It was
as simple as that. Matthew and Kat would never know it was her
that had both shot and saved Elizabeth. In some ways she
wanted to tell them, share their relief and excitement, but she
had vowed to stay away if she could. Maybe she would visit
them as Anne Baxter in a few years time, just to see if they
were all ok. She gave a smile. That might be fun. Play cat and
mouse with Kat, dropping subtle hints but not actually letting on.
Anne pulled out her PDA from under her chair and got it to
search the newsnets.
A few seconds later a list of hits came up on screen. Anne
selected the top one and a report from the European new
agency displayed the story of Elizabeth's miraculous recovery.
'Doctors treating Elizabeth Stephens are still both shocked and
puzzled at her remarkable recovery.'
Anne gave a wide grin. She done it! She read on.
'Ms Stephen's wounds have almost completely healed and
furthermore a previously undetected genetic flaw in her brain
had also been cured.'
That should keep Heinlein happy. With no flaw there was no risk
of Elizabeth relapsing into that monster Deianeria. If the flaw
were still in place Elizabeth would still be in mortal danger. Anne
read on
'The doctors treating Ms Stephens have reached the conclusion
that her remarkable recovery was cause by a previously
unknown genetic modification to her metabolism and recovery
systems at the time she was cloned from the late Dr Bexley."
Anne gave a wry smile, "Right person wrong reason," she
whispered to herself. Anne finished reading the rest of the news
report
'Ms Stephens will spend several months convalescing and in
physiotherapy, but it said to be in good spirits and looking
forward to her marriage to her fiancée Mr. Alex Richards. A date
for the wedding has not yet been set, but it is thought to be
almost certainly after she has completed her medical degree."
Anne's heart soared. Elizabeth was still going to marry Alex.
That was wonderful news! She thought back to her musings on
visiting Matthew and Kat. She would visit them on the eve of
Elizabeth's wedding. How could she stay away from that one?
Anne went back to the main news search list on her PDA. One
entry caught her eye it read 'Salah autopsy is the final nail in the
Children of Bexley coffin.'
'An autopsy of the Guild leader Salah has revealed rock solid
proof that DNA modification is indeed possible. This
comprehensively defeats the theories of the ailing Children of
Bexley cult, whose main evidence was the lack of proof that
DNA modification was possible. The Guild, who had arranged
for the body to be exhumed, stated that it was Elizabeth
Stephens who had instigated the request some months before.'
Anne stopped reading "The little minx," she said to herself with
some admiration. Elizabeth had done precisely what she would
have done to kill the cult for good. Such a request wouldn't
come cheap though. Anne read the rest of the article.
'The effect on the already declining membership of the Bexley
cult has been catastrophic. With their leader missing and
disgraced, and now this, it seems it can only be a matter of
months before they are forced to close. Matthew and Jane
Stephens have declined to comment on this matter but it must
come as some relief to them to know that their adopted
daughter is now safe once more.'
Anne gave another smile of admiration. "Take after your mom
don't you. Very neat Elizabeth, very neat indeed," Anne picked
up her glass of orange juice and raised it in a toast "To you
Elizabeth."
Anne stretched out her long legs and looked back out to sea
once more. The light was starting to dim and the fiery orange
glow of the sunset had faded into a deep, dark orange. Reading
about Elizabeth had lifted her spirits. There were times when
she had thought Elizabeth wouldn't make it, but now she had it
made her feel so much better. Her thoughts turned inwards. She
had been so busy these past few weeks she had had little time
to feel lonely or even introspective. Her work had been
everything to her, and now it was complete a feeling of
anticlimax was starting to set in. Sure a few days from now
when people had had time to read and digest her paper all hell
would break loose in the fields of marine biology, ecology and
genetics. It wouldn't do much for the mining companies stock
either!
If her work life was looking up her personal life was still in
tatters. Images of the cult leader, his intestines exposed,
swearing at her in pain, came into her mind. She had been right
not to wait for Mark. He didn't deserve her. Nobody did!
Why was it she could save the life of others but not when it
came to her own?
-- o -- o -- o --
Mark waited on the quayside for the sight of the 'Easu' coming
into dock. He had no idea what it looked like, but he guessed
he'd know when he saw the name on the side. He checked his
watch. She was half an hour late in docking, but there was still
no sign of her. He was down to his last twenty dollars in US
currency, and his credit limit was all but gone. If Anne didn't
show by midday he would have to leave without her. He tried to
relax and enjoy the sunshine and the gentle 'clink click' sounds
of the boats in the harbor, but he was finding it hard to
concentrate. Being broke in a foreign city was much worse than
being broke at home.
He had managed to see a little of the city during his stay. The
museum and memorial for the victims of the Guild attack was
free and open for all. It was a heartbreaking place to visit. The
only piece of film footage that existed was the well known shot
of a loud explosion in the sky and the sudden appearance of a
fine mist. A few seconds later the camera had panned to people
on the street slowing starting to dissolve and scream in pain as
the genetic warhead took effect. Ten seconds later the camera
was dropped as the person holding the camera succumbed to
the effects of the warheads. The Camera had continued to film
the carnage and remains of the population was killed around it.
Somehow the footage had survived the fires that had ravaged
most of the city, and now this was the only record of the attack.
Mark had read about how the heroic nation of Israel had
responded with a daring nuclear strike on Cairo and then in an
act of divine forgiveness had held back from destroying the Arab
nations. There were still trade and travel embargos between
Israel and Egypt, which was why he'd needed a new visa. He
thought it interesting that Anne's involvement in the whole thing
had been played down so that she was just a minor figure, an
addendum. Mark thought that the shame of obliterating the
entire city of Cairo by mistake was a wound that still ran deep. It
was also interesting that the Israeli government was trying to put
the best spin on it they could. Slaughter on a massive scale was
a difficult stain to remove.
Mark didn't mind the inaccuracies. Only one person
knew the whole truth and he was hoping to meet her! He did
feel nervous, as nervous as he had on their first date. This was
his last chance and he didn't want to blow it. He'd thought a lot
about how he felt about Anne over the past few days. In his
mind he had decided to keep calling her 'Anne', even though
she wasn't born with that name. It was, he felt an important
distinction. It helped him separate what she had been in the
past to what she now was. He didn't like to dwell on the past, it
served no good whatsoever. Wills had asked him how he felt,
wanting to be with a woman effectively older than his mother,
and he'd replied that he didn't see it like that. You were as old as
you felt and acted. It wouldn't matter anyway, only Wills and
himself knew about Anne, and there was no way Wills would tell
the truth. Who'd believe him anyway?
Mark was feeling hungry. He'd existed on junk food for the past
couple of days for the sole reason that he couldn't afford to eat
out. Mark stood up and walked a few paces in a circle. His legs
were getting a little stiff from sitting down for the past two hours.
Suddenly, in the corner of his eye he saw a tall woman with
blonde hair. The woman had tied it back into a pony tail, but she
was unmistakable. She was helping the crew of large trawler
type boat unload some trunks of some description. Unseen by
Mark, Anne had arrived and was nearly ready to leave. In his
mind he had imagined watching Anne majestically sailing in, and
her leaping into his arms when she had docked. He knew that
was a false picture, but it was one he'd clung onto. Still there
was no time and he ran towards her, gathering his thoughts as
he went.
Anne was just being handed a heavy looking box when she
noticed someone running towards her. That someone looked a
lot like Mark! She saw him look at her and wave, miss his
footing, trip over and fall flat on his face. She shook her head in
mild amusement. Mark always went to pieces when he was
nervous around her. It had happened when she'd pulled up to
help him with his car, and now this. Mark stood up and brushed
himself down. His face was bright red with embarrassment.
Anne acted as though she hadn't seen him and carried the box
to a waiting trailer. By the time she'd done that Mark was
standing alongside, waiting for her.
Anne turned to Mark and said, "Mark I'm sorry you've wasted a
trip. I can't see you anymore," Anne's voice was full of hurt. She
turned around and went to walk back to the boat. Conversation
over!
Mark was simply devastated. There was no other way to
describe the way he felt. Wills had sacrificed his car just so that
he could be here. Why was Anne blowing him off without so
much as a hello? Unable to face Anne he turned and started to
walk away.
Suddenly his hurt turned to anger. How dare she do
this to him! He wasn't just one of her pawns for her to use and
then dispose of! He had feelings and he meant for Anne to know
them. Ignoring his nerves he whirled around sharply, and took
hold of Anne's arm and pulled her back round to face him. Or at
least he tried to because quicker the he could see and in a
blinding flash of pain Anne had him in an arm lock from behind.
"I told you to leave!" she hissed.
Fuck, she was quick, Mark thought. Ignoring the pain he felt, he
said in his strongest tone, "No I won't go! You owe me more than
that! Wills had to sell his car for me to get here so I'm damn well
not leaving until we talk this over. Who the fuck do you think you
are? I know who you think you are, and I've come to tell you that
you are someone different! Now do I get my conversation or do I
tell everyone what I know."
Anne pulled Mark's arm tighter, nearly causing him to cry out in
pain. "You do that and you'll doom us all," She hissed.
"Ah yes your precious let's save the world project," Mark said
sarcastically.
Anne let Mark's arm go before she attracted too much attention
from the quayside. "You've just earned yourself that
conversation. But don't expect too much from me. It'll take me
an hour to finish up here. You know where the university is?
Meet me outside the life sciences faculty in two hours."
Mark's arm hurt like hell, and he moved it around to try and get
the circulation back. "Ok, My flight leaves in four hours. If I miss
that I'm trapped here. Until then, bye!"
"Bye," Anne said tersely. She was aware she had gone over the
top at Mark, but that was to test him. His spirited fight back had
shown her that he was here for a serious conversation, not some
kind of romantic reunion. That pleased her, she would be able to
explain to him her reasons for not wanting him close. She had
acted on instinct when he'd grabbed her from behind and the
fact she had nearly broke his arm proved her point. She would
use the incidence as evidence in her case.
Mark walked towards the campus. His arm still hurt but it was
his heart that hurt even more. He wasn't sure why Anne had
reacted like she had, but he didn't have too long to wait. His
PDA guided him back to the campus, it was a fair walk, but he
didn't have the money for a cab. The walk would do him good
and it gave time for his arm to stop hurting.
After finishing off, Anne waved goodbye to the crew of the 'Easu'
and jumped into her hired Lotus . It didn't take her long to drive
back to the Campus and she parked in her traditional spot, just
outside the life science's faculty. She took a deep breath and
calmed herself as she saw Mark waiting patiently for her on the
steps. He looked bored and thoroughly miserable. She walked
up him and said, "I'm sorry about the arm. You took me by
surprise that's all."
Mark shrugged, "It's ok. It's still attached, just."
Anne looked Mark in the eyes; "I know why you came. You
hoped to get back with me. You wanted to explain why you
pushed me away."
Mark gave Anne a sad puppy dog look "That about covers it."
"I'm sorry but your trip here was a waste of time. I'll pay Wills
back the money he gave you," Anne said softly.
"Why Anne? When we split up you told me you loved me.
What's changed?"
Anne shrugged, "Nothing, and that's the problem. Look, we'll talk
at my place. It's more private."
Mark nodded. His heart had sank to a deep dark pit and he
didn't feel like saying anything anymore. It hurt too much.
Anne led him to her car, and unlocked it.
"Nice car," Mark commented admiring the sleek shape of the
Lotus.
"Not a patch on my Porsche. This has a fuel cell, but it'll do,"
Anne said. They were making small talk, skirting around the
issue.
They turned out of the Campus and onto a busy freeway,
Everywhere people were going about their normal lives, "What's
it feel like being here? You feel responsible for what happened
here twenty years ago. It must hurt, seeing all those plaques
everywhere!"
Anne looked at Mark, "It doesn't hurt. Nothing does anymore.
The only way for me to live is without feelings. My heart is like
ice and my soul is stone."
Mark looked into Anne's blue eyes and saw the hurt and pain
she still felt deep inside her. She had covered it over by a
veneer of unfeeling logic, but he knew she still hurt inside. "I
went to the memorial of the Guild attack. They hardly mention
you."
Anne nodded, "I know. Just as well. Better let the world think
that the Guild succeeded rather than I failed. I know it's the
other way around of course. Sure, Israel has its propaganda, as
I'm sure Egypt does too. Listen, Mark, death follows me around.
I wrote in my letter to Matthew and Kat that I am death incarnate
and I still am!"
"Is that what you are afraid of? That I'll die and leave you
alone?" Mark said. At last he saw a breakthrough.
"It's just up here," Anne said, avoiding the question and pointing
to a set of apartment blocks. She didn't come here to have
counseling by Mark. She came to say goodbye.
Taking the hint Mark fell silent until they had parked and had
caught the elevator to Anne's dorm. As he walked into it he was
impressed by the standard of it. It was decorated in a modest
but somehow elegant tone. He would describe it as classy and
not brash at all.
"Drink?" Anne asked.
"Sure why not? OJ please," Mark said softly and sat down on
the sofa.
"Thought so," Anne gave a sad smile. Mark always had orange
juice when he was upset. He'd described it as better for him
than beer, and Anne had to admit he was right.
A minute or so later Anne handed Mark a glass of orange juice
and sat down on the opposite chair. She braced herself for what
she was going to say. "The reason why we can't be together
isn't because I don't love you, because I do. It's because you
were right about me."
"How so?" Mark said softly.
Anne looked at Mark, "Mercy isn't in my nature. You don't
deserve me Mark. I'm more bad news than you can handle."
Mark glanced across at Anne. He was still too hurt to look her in
the eyes, "That's what you told me on our first date. As for more
bad news, that's for me to decide isn't it?"
"You do not understand," Anne said softly.
"Then help me to!" Mark demanded.
"You know what I told you about my past don't you?" Anne said.
This was going to be hard but it was only way to make Mark
understand.
Mark nodded, "Sure! You're Dr Bexley, you faked your suicide
and worked for the CIA until you decided to do Marine Biology."
"I didn't tell you everything about my time with the CIA. I wasn't
just a courier or a smuggler. They used my skills to kill people,
people they couldn't get close to by normal means. What I'm
saying is that I am an assassin. First I join the Guild of
Assassins to try and take them down, and then I end up as one
anyway!" Anne averted her eyes downwards. She had killed
people in the name of truth, justice and the American way.
"I figured as much. It doesn't matter! That's in the past, years
ago!" Mark said.
To Mark's surprise tears formed in Anne's eyes. She gave him a
tearful look and said, "It's not all in the past. That's the problem!"
Mark looked surprised. What was Anne saying?
You read about Elizabeth, my daughter's kidnap right?
Mark nodded. He had been worried about Anne.
"My old boss called me up and told me in no uncertain terms
that the risk of Elizabeth manifesting the same MPD as affected
me was too great. If she had the same symptoms then I was to
kill her. If I didn't, someone with less experience would." Anne
tried to fight back the tears.
Mark looked into Anne's eyes for the first time since he'd sat
down, "That's horrible. So she wasn't shot trying to escape? You
did it!"
Anne took a deep breath and wiped her eyes dry, "I did it. I had
no choice."
Mark gave Anne a comforting look, "But she's ok. She lived!
Your super healing modification you built into her saved her. Or
at least that's what the news said the other day."
"There was no such healing modification. If you remember back
to that conversation we had when I first told you about me. I told
you I had managed to cure myself permanently of the flaw in my
brain," Anne said.
"Yeah I vaguely remember. I was a bit shaken up so I don't
remember all the details," Mark said.
"After I'd left I tried to get some sleep. I was so down at the way
things had worked out. I really thought we had something
special, but on looking back it was for the best. I'd just woken up
when my previous employer told me he needed me again. He
gave me a stark choice. Subject Elizabeth to a test and shoot
her if she failed, or let someone else do it. If someone else did
do it then it was very likely they would make a mistake. I
seemingly had no option. If I was to be in a position to save my
daughter,s life I had to go along with it."
Mark shook his head in disbelief. What a horrible choice to
make. "So that's where you went to those few days."
Anne nodded "Yeah, I went looking for her."
Mark gave Anne a puzzled look, "But she was found the day
after she went missing. How'd you find her so quickly?"
Anne looked away from Mark, "I'd rather not talk about it."
Mark gave Anne an incredulous look, "Is it classified?"
Anne pursed her lips slightly and shook her head, "Not all of it.
But what I did in my anger at her kidnappers was so awful, so
horrible and so vicious it still gives me nightmares. It's why you
don't deserve me."
Mark became slightly annoyed, "Why don't you let me make that
decision."
Anne gave a sigh, "Please don't make me talk about it!"
Mark gave Anne a look of sympathy "If you want me out of here
then you have to tell me. It'll help you too."
Anne shot Mark a look of resignation. Maybe it would do her
good to tell someone, "We knew who had been behind the
kidnapping, but time was running very short for Elizabeth's
sanity. We knew the Children of Bexley wanted to put so much
stress on Elizabeth that it would cause her MPD flaw to come to
the front. That Elizabeth's alternative personality would force it's
way into Elizabeth's mind and suppress the real Elizabeth. Just
like what happened to me. So I went straight to the cult leader,
kidnapped him and took him to a safe house."
"And you revealed yourself in all your glory so he told you where
Elizabeth was being kept," Mark stated.
Anne shook her head, "I tried that. He didn't want ME back -- he
wanted his own little controllable Dr Bexley that he could use for
his own ends. He knew he couldn't have me, so he wanted
Elizabeth instead. By this time I so furious at what he'd done to
Elizabeth, and at his making out that some of the truest friends
I ever had were murderers and liars, that flaw or no flaw I wanted
to kill him. He still refused to tell me where Elizabeth was. Time was
running short and I was seriously pissed off at his arrogant
attitude."
"So what did you do to him?" Mark asked quietly.
"His main argument against the Fury was that DNA Modification
was not possible. I showed him it was by turning him into a copy
of the original me. I asked him again and still he refused so I
turned him back."
Mark was horrified, "Anne that's outrageous! Who gave you the
right to do that to him!"
"Now you are starting to see what I mean. Still he held out as I
verbally took apart everything he believed. By the time this had
happened I was more furious at him and fuelled by my concern
for Elizabeth I had to resort to drastic methods."
Mark looked shocked as he had a thought, "You turned him
back into a woman. Is that why he can't be found?"
Anne shook her head and looked down. "No. If only. I took him
apart bit by bit until he told me where Elizabeth was."
Mark looked puzzled. "I thought you'd already done that?"
Anne looked away from Mark, her head hanging in shame, "Not
verbally, literally. I tortured him by removing his internal organs
one at a time, while he was still alive and with no anesthetic. I'd
given him drugs to ensure that he stayed conscious but that was
the only drug I gave him. Eventually he told me, so I put him out
of misery."
Mark sat back on the sofa in shock. This last act wasn't years
ago or when Anne had been insane. It was only a few weeks
old. He was so shocked that the words refused to come out.
Anne smiled a weak smile "Now you see don't you. Mercy is not
in my nature. I thought I had left the past behind when I became
Anne Baxter, built a new life as her and even," she looked at
Mark, "fell in love. But I'm a monster. I kill without mercy, but
then weep about it afterwards. I've not changed from all those
years ago, have I?"
Mark tried to get away from the image of Anne slowly cutting out
the cult leader's organs one by one. He was no medical doctor
but he could visualize the amount of blood, gore and pain the
cult leader had felt. He decided to move on and change the
subject. His brain wouldn't take it in all in one go and he needed
to give it some time, "So you flew to England and found
Elizabeth."
Anne nodded. "The cult had relied solely on secrecy and so only
had one person guarding Elizabeth. I broke into the house,
stunned her, and then confronted an unconscious Elizabeth. Not
wanting to move I waited until she woke up. What
confronted me there was the stuff of my worst nightmares."
"You were too late?" Mark asked.
Anne nodded. "I made a tape recording of her. Her MPD
personality had taken over Elizabeth's mind completely. She
called herself 'Deianeria'. After much verbal fencing I managed
to get Deianeria to open up to me. She described how she
would get her revenge on her parents and Cathline for ruining
her marriage to her fiancée, Alex. She described in vivid and
horrific detail how she would get Kat and Cathline to fuck each
other, under pain of death. She described how she would join in
until they had all come. Then she moved onto Matthew and her
brother, John who had been chained up. She told me how she
would fuck and then castrate them, give John hormones so that
he would become female and keep Matthew as her personal
sissy slave. She then told me how she would kill Cathline and let
me have Matthew for my own use. She described all this as if
she was getting really turned on by it. It chilled me to the bone
just listening to her."
Mark breathed out, "I see. So this Deianeria was utterly evil.
From what I've heard Elizabeth's personality had already been
taking over."
Anne nodded, "The worst thing was that as Deianeria was
speaking I recognized myself in everything she'd done. The
fucking, the emasculation and the murder I had all done. Not
just in the past, but just recently when I mutilated the
cult leader. I was supposed to be cured and a reformed character,
but how could I justify the methods I had used to find her? All
these years I thought I'd come to terms with what I'd done to people,
but in reality I'd buried the feelings away and ignored them. Hearing
Deianeria tell me her darkest thoughts was like listening to myself.
Deianeria and I are so alike. That was what made me realize
that we couldn't be together any more."
Mark saw where Anne was coming from. It wasn't that she didn't
love him; it came from a fear that she would hurt him, and from
a conviction that she wasn't worthy of anyone's love. He
decided to pick his moment before mentioning it, so he said,
"So she failed the test."
Anne looked at Mark. Her face showing that she was hurting
inside, "Yes. I had to find a way to save her life, satisfy my
bosses that she was dead, and get rid of Deianeria. I'd worked
out what I was going to do beforehand, but whether it would
work or not was a different matter. I was desperately worried
and almost thought she was dead a few times. You ever heard
of the work Dr Yuri Kopaev? And the treatment I performed on
Detective Tina Cox?"
Mark shrugged. "Can't say I have."
Anne explained, "Back in 2012 Dr Yuri Kopaev speculated that if
you shut down the body, to a deep coma almost to the point of
death, and then bring the person back to consciousness the
MPD personality that was being manifest would it had
died and shut down."
Mark shot Anne a quizzical look, "So you convinced Deianeria
that she was dead. She then effectively died so that when
Elizabeth came back only Elizabeth would remain."
Anne nodded, "He called it 'the cold boot' theory. It's the same
theory as powering off a computer to clear out its memory
before you restart it. He never got it to work right because he
could never get the patients back again. In his paper on it he
was convinced he could make it work and so was I. You
remember how I cured Detective Tina Cox?"
"Nope. Sorry," Mark admitted.
Anne put on her lecture tone of voice, "She had suffered very
serious spinal injuries as a result of a fight with a Guild
changeling. I had managed to stabilize her condition but she
was still in a deep coma. The only way to cure her was to inject
her with a very slow acting DNA modification serum. It would act
cell by cell, allowing the body to recover after each small
change. If it had been too fast acting the stress of the changes
would have killed her. I used the same technique with Elizabeth.
My gunshot had to be serious enough to place her in the coma,
and make my employers think I'd killed her, but not so serious it
would kill her outright. As soon as I shot her I called the
paramedics and followed her to the hospital. I hung around the
hospital for a day or so, first as a nurse and then as a doctor,
making sure that her condition was ok. Her brain had almost
shut right down and her body was on bio support. According to
Dr Yuri Kopaev's paper she was in the ideal condition for 'a cold
boot'. I came to her a day or so after I'd shot her, and using all
my concentration formulated in my changeling organ a slow
acting DNA regeneration drug. It would slowly start to heal the
damage the bullet had caused and then heal the flaw in her
mind. I knew the formulae because I performed the same
operation on myself."
Mark raised an eyebrow in surprise. He'd heard that Anne was
an exceptional surgeon and planner but this was truly brilliant
"Anne that's stunning."
Anne shrugged the compliment off. She remembered
injecting Elizabeth and the subsequent worry about her
condition. "On anyone else it would have failed. I knew what her
metabolism was, it's limits, and everything, because I lived in
that body for twenty odd years. Her condition worsened as the
drug slowly took resources from the mind and body with which
to work. I had to hope that Kat would refuse the doctor's request
to switch off the machines. If they had switched them off too
early then Elizabeth would have died. I've known Kat for years.
She regards life as the most precious thing there is. I gambled
that Kat would stand firm until there was no hope at all. From
reading the news reports, I was right. It worked Mark. It worked!"
Mark saw Anne's face light up. Maybe there was some hope for
them after all. "It sounds as though it was one hell of a risk. You
must have been worried sick about her."
Anne nodded. Her blonde hair fell in front of her eyes, so she
brushed it away, "I was, but I had to get on with my project. If I'd
delayed any longer, then more would die. I had to trust in my
friends and Elizabeth's will to live. Anyway, it seems as though
my plan worked. My bosses were satisfied because I had shot
and killed Elizabeth. Elizabeth's flaw was cured so Deianeria
could never return, and since Elizabeth no longer has the flaw
my bosses have no reason to eliminate Elizabeth."
Mark smiled. He saw a way thorough Anne's pain. "Can't you
see that you cured her. The world will never know the real truth
but you saved her life. How can you be the evil monster you see
yourself as if you did this?"
Anne looked at Mark, "Even monsters save their own children."
Mark took a sip of orange juice. His mind needed time to come
to terms with what Anne had just told him. Anne, seeing a
natural break in the conversation stood up, walked towards the
window, and looked out over a bustling Tel-Aviv.
Mark stood up a few seconds later and walked over to Anne. He
turned to face her and said "When you first told me who you
were, I panicked. I had fallen in love with Anne Baxter only to
find that she was Dr Elizabeth Bexley. That thought freaked me
out, and it wasn't helped by recurring nightmares of what you did
to those gang members."
Anne gave Mark a knowing look, "You were right about me. I'm
not the woman you fell in love with. You fell in love with sweet
little Anne Baxter, not who I really am. Death incarnate and 'Hell
bitch'"
Mark shook his head, "I fell in love with you. You are older than
me, but so naive."
"How so?" Anne said, and returned her gaze to the view of Tel-
Aviv.
"You know, there's an old adage that says 'get a life' You need
to get yours back again! You think you have some ideal to live
up to. You spend all your life trying to make up for what you did
in the past. You turned Matthew back and tried as best you
could to make up for what you'd done to him. You then try and
stop the Guild because they were going to use your invention as
a weapon, and then after Tel-Aviv and Cairo have been
destroyed you start a new life as Anne Baxter and try to save
the worlds Oceans. You've spent the last thirty years trying to
make up for your mistakes. You murdered those gang members
and the cult leader so you save your daughter's life to try and
make up for it. Your only achievement in the past thirty years of
getting yourself sorted out is to find different and better ways to
run away. 'I need to go and find my own path, only I know what's
good for me.' What a load of self-indulgent crap! It's time you
had a life rather than just lived one!"
"So what of it. I have to at least try," Anne snapped. Mark's
words had stung deep. But what she couldn't refute was that
they were true.
Mark stood closer to Anne, She needed to know he still cared
for her, "Yes but you do it at the expense of those who love you.
You punish yourself because you feel you deserve to be
punished. You not wanting me around has nothing to do with
you being a monster and merciless killer. It's more to do with
you not feeling worthy to have anyone love you. I spent months
in a fit of self pity because I thought I had lost you for good. It
wasn't until I came through it that that I realized that love is deeper
than just self absorption, infatuation and a bulge in my pants!"
Anne remained silent. Marks words started to eat into her soul.
He had a point of course. But to open her heart fully up to him
was a big step. She turned towards Mark once more and said,
"You don't think I've thought of all this? You don't think I've
tried all of this before?" Anne tried not to let sarcasm creep into
her voice.
"Yes but every time you've tried it it's only been you. You've
been pulling on your own resources and yours alone. Sure
you've read around it and studied counseling theory, but it's only
been you. Anne, how do you really feel?"
Anne turned to face the window once more. "I feel old. Worn
out."
Mark put his arm around Anne's waist and to his surprise she
didn't pull away, "Let me make you feel young again. Maybe the
reason why you've not been able to see your way clear is
because it's not a job for you alone. Anne, let me into your
heart."
Anne shook her head, "I can't! My heart is ice and my soul is
stone. You said you were in love with Anne Baxter. She's only
an alias."
Mark pulled Anne closer, "No she's not! Wills made me see it
and it's why I came here rather than just walk away. You
couldn't live the life of Anne Baxter for five years without her
being the real you. Nobody can act that well, Anne Baxter is
how Dr Elizabeth Bexley is now, not how she was fifteen, twenty
or thirty years ago."
Anne turned to face Mark, her eyes moist with tears, "Then
Anne Baxter is a monster! She kills in the most brutal way
possible and without mercy! I haven't changed at all!"
Mark shook his head, "Anne Baxter is the woman, who helps a
stranger with his car, shows her love for her boyfriend by
exposing her greatest secrets and fears to him. She saves the
life of her daughter and then slips into the background so her
daughter can live in peace with her adopted family. Anne Baxter is
the woman who leaves her stricken daughter to work on
something that will save an entire ecosystem. Anne Baxter is
the woman who trusts her friends enough to leave the life of her
daughter in their hands. Anne Baxter is.."
"Alright I get the picture," Anne said softly.
Mark looked Anne in the eyes. The tears had ceased, and a
spark of hope was there. He smiled and said, "I'm not sure you
do. I'm glad I wasn't there to see what you did to the cult leader
but that side is part of who you are too. We all have our darker
sides. That part of us we keep hidden and away from sight. It's
the part of us that wants to dominate others, the part that drives
natural selection onwards and the part we draw on when we
need strength beyond what we can cope with. I think this
Deianeria was Elizabeth's darker side unleashed and without
restraint. That's the difference. In every case you said you did
what you could before taking the final step. With those gang
members you tried to negotiate and protect me. With the cult
leader you tried the thing most likely to get him to talk first. From
what you've told me you use force as a last resort. That's not
acting in an evil way is it?"
"You're only saying that to make me feel better," Anne said
softly.
Mark smiled and took Anne's hand. Again she didn't pull away,
"I've had weeks to think about this. I'll say it again, you've spent
years trying to sort this out yourself and by yourself, and it's not
got you anywhere but deeper in. You need to move away from
thinking me, me, me but you can't because you are not capable
of getting away from yourself."
"I knew that's what I needed to do. That's why I love you. You
made me feel like my original me again. Not like Anne Baxter or
a 'hell bitch' but like me before I met Matthew. Mark I'm so messed
up inside I can't feel anymore. I should be crying but the tears
won't come. I'm dead inside. You're wasting your time with me."
Mark pulled Anne closer towards him, "Wasting my time? If I
thought that I wouldn't have plunged myself into debt, called in
every favor I can, and flown 8000 miles to see you, would I?
Anne what you've told me today and beforehand only confirms
what I knew from the first time I saw you, that you are a most
remarkable woman."
Anne pulled back, away from Mark, "What you're trying to do
isn't going to be achieved in a few hours talking or even a few
weeks. I can't ask you to do this for me."
Mark looked into Anne's eyes and his heart soared. She was
looking at him with an expectancy and hope that had been
missing for so long, "I'm not asking this to be a short term thing
and you didn't ask me to help. I'm offering it because Anne
Baxter or whoever you are today, I'm so deeply in love with you
that I can't imagine living without you."
Anne gave Mark a look. He didn't know what he was letting
himself in for. But was he the ONE? Her instincts told her he
was. Her heart or what was left of it told her he was. So why did
she still feel unsure? One thing she did know, and that was that Mark
loved her. She had told him everything she had done and he
was still willing to stand by her. That told her something. Maybe
he was the right person to melt her heart and turn her stone
soul back to flesh. She was in love with him, that much was
clear. He made her feel young again, as though the fury and its
consequences had happened to another Dr Elizabeth Bexley.
He had Matthew's innocence but none of his naivete. He shared
Matthew's compassion and heart but was prepared to stand with
her rather than flee. Mark's trip to be with her in Israel proved
that. Mark wouldn't jilt her or run away. He would stand
alongside her no matter the consequences. She pulled him
closer so that their noses were almost touching, "I hope You
realize I mate for life?"
Mark moved in and gave Anne a loving passionate kiss, "I
wouldn't have it any other way."
Anne returned the kiss and felt the years fall away from her. The
block of ice that was her heart had started to thaw and although
it would take a lot of time, pain and soul searching, she knew
that together they would make it. She pulled away from Mark's
kiss and gave him a loving hug. Her eyes crying with tears of joy
and freedom. Finally she was free.
-- o -- o -- o --
Two Years Later.
The 60 foot research vessel 'Hera' drew to a stop and with the
help of frantic activity by its ten man crew it weighed anchor and
drifted gently on the turquoise ocean. Inside a young man and
his stunningly beautiful blonde fiancée stood inside the bridge
and were reaching the climax of a hectic two years work
"I think you should do the honors," Mark said pointing to a
switch on the bridge.
"I should think so," Anne said with a smile.
"I still can't believed you convinced the UN to let you do this!"
Mark said, and gave Anne a peck on the cheek.
Anne returned the kiss, "I can't believe it took them a year to
decide! Just as well I started while I was still at college. At least
we know have a chance!"
Mark gave Anne an incredulous smile, "A chance! Hah. All the
results of the trials have shown a 70 percent improvement over
your estimates. If this goes well then the decline of the marine
ecology will be well and truly over in thirty, not sixty years! I
must say I'm still stunned by the audacity of your scheme and I
knew about it two years ago!"
"Well you know me, I always like to go one better than the rest,"
Anne said with a smile.
Mark shot Anne a look of admiration, "Only the great Dr Bexley
would think of genetically modifying Plankton so they ingested
and broke down what ever pollutants were in the water and so
cleaned the water as they bred."
Anne gave Mark a friendly prod, "Oh come on there's more to it
than that. I had to limit the number of generations so that they
didn't breed out of control. Alter their shape so that the plankton
eating animals and plants didn't die of poisoning. They also had
to float to the top of the ocean and stay there so they could be
collected and not let the pollution get back into the ecosystem
again. You know the brief. I had to almost redesign the marine
food chain to get this to work properly! That's what took the
time, that and triple checking," As she had thought it had been a
real battle to get her idea firstly accepted, and then recognized
by the scientific community. At first they had laughed it off and
then as they investigated the evidence called it grossly
irresponsible. Anne had not given in however and the first shore
based trials in the Black Sea had proven the idea beyond doubt.
The water quality in the Black Sea was back to the levels of the
late 1930's and was still improving. Thanks to her safeguards
the effects on the ecosystem and food chain had only been
beneficial and now at long last she was about to perform the first
clear up of an entire Ocean. The effects would take far longer to
be measured but they would know for sure in ten years time.
Mark thought back to Anne's interviews with several mining
companies. They had seen the potential almost as soon as
Anne's paper was published, "I liked the idea of getting this
modified plankton to extract minerals from sea water. The
mining companies are falling over themselves to sign up for
usage licenses. I think I could get used to marrying a billionaire!"
Anne smiled, "Let's not get ahead of ourselves. First we need to
dump these forty tons of GM-Plankton 260 and then can pay
some old friends a visit."
"You sure you really want to visit them? You've stayed out of
their lives for twenty odd years," Mark asked. He wasn't worried
about Anne. It had been hard work overcoming her past and her
lack of self esteem but they had stuck together thru it all and
were now closer than ever. They had come close to splitting up
a couple of times, but never as close as when he'd
visited Tel-Aviv just over two years ago. Whenever she wanted
to push herself away he had stayed by her side and just loved
her back.
Anne thought for a few moments, "Yes I do. I promised myself
I'd see Elizabeth just before she got married, just to make sure
she is ok. I know she is, but I want to see her just the once. This
time I promise I won't shoot her!"
Mark grinned. "Ok, how are you going to play this?"
Anne raised an eyebrow, "I've got it all planned out. After we've
dumped this we'll take an inflatable and sail to their island. We'll
tell them there's been a fire on board and we need to radio for
help. I'm sure they'll invite us for a meal so we'll stay a while and
then after I've seen everything's ok with them we'll leave."
Mark gave Anne a hug, "I thought you'd have it all worked out.
That's why you wanted to dump the first batch in the Indian
Ocean isn't it? How far is their island?"
Anne took hold of Mark's hand and have him a kiss, "You know
that's the reason we came here! I told you it was, silly! Their
island is about 3 hours away from here. Anyway it's almost time.
Make sure we're all set for me one last time.
"Done," Mark said and checked the release mechanism. A few
minutes later he said "All ready when you are."
Tears of joy formed in Anne's eyes. The last time she was here
she had vowed to stop the rape of the oceans. Now some thirty
years afterwards, she had succeeded. Anne walked over to the
switch and with a determined movement of her finger
she flipped the switch.
Underneath the boat a series of pipes opened, equalized the
pressure, and let out the modified plankton. As soon as they
were in the water the plankton would start to filter out pollutants
before finally dying and floating to the top for scooping up
afterwards. The UN had provided a flotilla of ships to do the
clear up in a few weeks time. They would track the plankton by
using currents and satellite imagery and so skim off the dead
plankton, thus clearing the ocean.
Anne walked away from the switch and felt the boat rock slightly
as the last of the plankton was released. She thought back to
her time in exile as a mermaid. What had she said at the time? It
came back to her a few moments later and she repeated out
loud, "I am Scylla, daughter of Poseidon, Guardian of the
underworld which are the oceans of this world. Mortal man listen
to my siren song and tremble."
Mark drew alongside her and pulled her close. She had done it!
"We'd better get underway if you want to go visiting. How do you
feel?" he said.
Anne put her arm around Mark's muscular waist, "I feel young.
As though the world has just been born and this is the first day
of creation. Mark, I feel reborn, forgiven and free. Now it's time
to bury my past, so I can have a future with you."
-- o -- o -- o --
Matthew and Kat were walking hand in hand along the beach.
Matthew's hand was around Kat's waist and her head was
resting on his arm. They heard the sound of a motor launch
heading towards them and they turned to face the sound. A
small inflatable boat was slowly making its way thru the swell
and was about to dock at the jetty. Inside the boat was a young
woman with long blonde hair and wonderful curves. Standing
up, steering the boat was a tall man with dark hair. By the looks
of them they'd been at sea for a while.
Matthew called out a greeting to them and the man waved back.
Kat had already started to run to the jetty to investigate. By the
time Matthew had reached the boat it was already tied up and
the man was helping the young woman from the boat.
"I'm so glad that you're in. Could you please help us?" Anne
said. Anne was relieved that both Kat and Matthew seemed to
be doing just fine after the trauma they had gone thru two years
ago.
"What's the problem?" Matthew said.
Anne studied Matthew's face. It still had that boyish look of
innocence about it. He'd never lost that look, even after so much
pain and hardship Anne thought. She recovered herself and
quickly replied, "Sorry. Introductions first. My name is Dr Anne
Baxter. This is my fiancée Mark. We're marine biologists
researching the effect of man's pollution on the reefs around
here. We suffered a fire aboard our ship that knocked out all
our radios and damaged the rudder. Can we use your radio to
summon help?"
"Sure. Does anyone need any medical help? We've a doctor
here at the moment I'm sure she'd like to help," Kat asked.
Of course! Anne remembered Elizabeth has passed her MD at
an even higher grade than she had. 'Bitch!' she thought to
herself, but inside she was very proud.
"No the rest of the crew is fine. The ship is about ten miles out
from here so we took the dinghy. Besides, I used to want to be
a medical doctor, did all the training and everything but the
ocean holds a greater calling." Anne answered. She was
relieved. Elizabeth was here and she would get to meet her!
"You look famished. Why don't you come inside? It's our
daughter Elizabeth's wedding in a couple of days so you'll
excuse us if we're a little busy."
"Hey I recognize you now, from the TV. You were at President
Jameson's swearing in. Now I know who you are. Aren't you
Matthew and Jane Stephens? " Mark said.
"Yeah. We try and keep a low profile nowadays. If you've got
time why don't you stay for some dinner? I'm sure Elizabeth and
John won't mind."
Anne gave Mark a nod and then said "Yeah love to. Just let us
call for help first."
"Agreed. Matthew'll show Mark to the radio. You can walk with
me?" Kat suggested.
"Thanks. Say, for a woman of fifty something you look very
good. Sure hope I look as good when I'm fifty," Anne said. It felt
strange, walking back to the house at her ease, with a woman
she had caused so much suffering to, with whom in fact she
shared their daughter, and as someone other than Dr Elizabeth
Bexley. But now Dr Elizabeth Bexley was living on borrowed
time. After this trip she would be gone and only Dr Elizabeth
'Anne' Baxter would remain.
She thought to herself, I look better than you do and I am fifty
She had to hold down a smile at that thought.
"I had some outside help. Say, you and Mark look well suited.
How'd you meet?"
"We met at college. His car had broken down on the campus, I
was driving past and I helped him fix it. We just seemed to hit it
off right away. He's my soul mate. I guess you know all about
that?" Anne said. Her journey to meet her soul mate, Mark had
been longer than Kat's but now she was with him it had been
worth every minute. It pleased her to see Kat still as much in
love with Matthew as she'd ever been.
Kat smiled. "You bet."
-- o -- o -- o --
"The Radio's just thru there," Matthew pointed to an old looking
radio set that was perched on a nearby table.
"Thanks. I'll only be a few minutes."
"Fine, want me to show you how to use it?"
"Nah, I can still use these old silicon units. She's quite a woman
isn't she?"
"Who, Kat?"
"Yeah. She reminds me of my Elizabeth Anne. She doesn't use
her first name much, in case you were wondering, but I like it.
And I love her! Anyway, If she hadn't have been there to help
me fix my car I'd have missed my exam and failed my doctorate.
She's irreplaceable!," that's an understatement, Mark thought.
Both of them owed everything they held dear to Anne's
ingenuity and courage.
Matthew smiled "It wasn't snowing, was it?"
"Umm no. Oh yes, I get it. I've read about you and that Dr.
Bexley. We did about you in school, you know! No it wasn't. I'd
better make the call," If only Matthew knew what was really
going on, Mark thought.
"Fine, I've got dinner to get ready. The dining room's down the
corridor and third door on the left," Matthew said, and left the
room.
Several minutes later Mark joined Matthew, Dr Baxter, and Kat
in the dining room. The fake call to the coastguard had been
made.
"Hi hun, I've just got off the radio. They say they've sent a ship
from Male to tow our ship back to port for repairs. It should get
there in a few hours," Mark said.
"Great. Come down and sit next to me," Anne said, and
patted the seat next to her.
"Ah, young love," a nightingale voice said from behind them.
"Dr Baxter, Mark, I'd like you to meet our daughter, Dr Elizabeth
Stephens. Soon to be Dr Elizabeth Richards," Kat said.
"As if I could forget. All I've been doing for the past month is
getting ready for my wedding. Anyway, nice to meet you.
Heard you had some trouble with your boat," Elizabeth said.
"Yeah all sorted now," Mark said, staring at the tall auburn haired
woman with the blue-gray eyes. Anne had told him so much
about her. He thought she looked cute, not a patch on Anne of
course. Anne had spoken about her daughter with so much
pride and love. Now that he saw her he knew that she wasn't
wrong.
Dr Elizabeth Stephens sat down beside Matthew. "Hey dad,
where's that pesky brother of mine? He's always late for dinner."
"Probably still working on his thesis. Go and get him would you
dear?" Kat said to Elizabeth.
"Sure mom," Elizabeth replied and got up and walked out.
"Smart girl and beautiful too. You must be very proud," Anne's
heart leapt. Elizabeth was fine, more than fine. She looked
radiant and so much better than the last time they had met.
There were no signs, physical or emotional of her brush with
Deianeria or death. That thought pleased Anne a great deal and
she felt another burden lift from her. It was another step in her
healing process. She had of course seen Elizabeth in various
magazines but seeing her alive and so much in love warmed her
heart. It was all she could do not to run up to her and give her a
hug.
"We are. We're proud of both of them. Elizabeth beat the class
record at Harvard set by the late Dr Bexley by a fraction of a
point and John is looking set to graduate with honors at Yale.
All in all we're very happy."
"Changing the subject, I hear they've nearly decontaminated
Cairo. It should be habitable within the next five years or so.
Shame about the pyramids and Sphinx. I always wanted to see
them. They must have been impressive," Mark said. He wanted
to change the subject quickly. Anne was playing a dangerous
game.
"I guess. We only saw them in a blur on our honeymoon. We
had other things on our mind at the time. But that was a LONG
time ago. Too long," Matthew commented.
"Almost a lifetime," Anne said softly. Again she fought down her
emotions. These people belonged to the past. Her future was
now with Mark. She had been right to come and say goodbye,
this wasn't just goodbye to a few old friends, it was the burial of
her past history. She had moved on from it, and it gave her a lot
of pleasure to see that they had too!
A tall man with black hair and dark brown eyes walked in "Hi
Dad, what's for dinner?"
"Mark, Dr Baxter I'd like you to meet our son, John," Matthew
said.
"Pleased to meet you," Mark said and held out his hand.
Shaking it John said, "Pleasure."
"Say, I'd like to write a congratulations note to Elizabeth and her
future husband," Anne asked Anne thought. Time for me to see
whether Kat is as sharp as she used to be. I need to say
goodbye properly without giving myself away to the rest of them.
"Sure. I'll go get some paper," Matthew said and went to a
nearby drawer, rummaged around for a bit and came back with
a notepad and pen.
Taking the pad and pen Anne thought for a while and then wrote
on the pad. "I'll keep this until after dinner," she said.
Elizabeth soon joined them and sat down at her place next to
Matthew.
After dinner Mark and Anne bade their farewells. Anne
handed the note to Kat and then walked off with Mark to their
waiting boat.
"What's the note say?" Matthew asked.
Kat scanned it and read out,
'Wishing my sister bride all the best in her upcoming
marriage. May it be fruitful and give you all your hearts
desire. You are very fortunate to have parents who love
you and each other as much as they do.
Dr Anne Baxter (Scylla) and Dr Mark Andrews.'
Kat thought for a moment and said "Nice of them to do that. Oh
rats, they forgot something. Don't worry I'll go."
Kat rushed out of the door and just heard Matthew call "Hey,
you forgot what they forgot!" Ignoring Matthew's call, Kat
sprinted down the steps to the jetty and just made it in time to
see Anne get into the boat.
"Dr Baxter, wait!" Kat called out.
"What's up?" Dr Baxter called out. She hasn't lost her touch,
Anne thought. She calmed herself. It wasn't everyday you said
goodbye to thirty years of past history. She felt a little sad, but
she knew from seeing them all again that they had emerged
from the horror of Elizabeth's kidnap stronger than ever before.
"You left something behind. A wedding present from Matthew
and me."
"Hey thanks," Anne said, got out of the boat and walked towards
Kat. Anne smiled to herself.
"Hi witch, a little bit different from when we last met on this jetty
isn't it?" Kat said.
"Pardon?" Anne said, a surprised look on her face. 'Witch' was
Kat's pet name for her so many years ago. Kat using it was the
final proof that Kat knew. Now the question was what would she
do with that knowledge. Anne decided to play coy. It was for the
best.
Kat decided to lay her hunch on the table, "Come on Liz. I've no
idea how you pulled it off but you can drop the pretence. It'll be
our secret."
"Sorry Jane. Dr Bexley's been dead for over twenty years.
She's not a part of your life anymore. I suggest you let me get
back to Mark and my crew. It's been a pleasure meeting you."
"Then why all the hints? The Scylla thing? That was the alias
you gave yourself when you were exiled to the ocean as a
mermaid. What about you wanting to be a MD and then
changing your mind? If you still had a changeling organ you
could make yourself younger. The deal you did with the
government could've given you a new life and faked the
suicide. What about the sister thing on Elizabeth's note?"
"Jane, Dr Bexley is dead and buried. I suggest you leave her
there. The rest of the world has so why can't you? Missing your
Moriarty huh?"
Kat nodded. Was this woman standing before her really her
arch nemesis, Dr Elizabeth Bexley? Kat had to admit she wasn't
sure anymore, "I guess so. I knew the way she operated better
than most, makes me a little paranoid sometimes."
"I understand. She still haunts you both doesn't she?"
"In a way. Part of us believes that she's faked all this and that
she's alive somewhere making a new life for herself."
"What if she is? Would she want your interference? Would you
want hers?"
"I guess not," Kat admitted.
"Then leave her in her grave and look forward to the years you
have ahead of you."
"You're right of course. Say, do you want to come back in a few
days and be at Elizabeth's wedding."
Anne thought for a moment. She would have loved to come but
she didn't trust herself to stay quiet and anonymous. She had
seen all she had wanted to see. Elizabeth was now as happy as
she was, and that was all that mattered to her. Matthew and Kat
were as in love as ever and all was as it should be. She herself
had so much yet to do and so much she wanted to do.
She looked at Kat's deep brown eyes and said, "No thanks, I've
grown out of being the uninvited guest. Thanks for the offer
though, but I need to get our ship repaired and operational
again. Hope I can drop in occasionally?" She had no intention
of coming back. This was the goodbye she had wanted to say
for so long.
"Anytime," Kat said softly.
Anne turned to go and walked towards the waiting dinghy.
"Oh Dr Baxter?" Kat called out.
Anne turned around "Yeah?"
"Thank you," Kat said.
"My pleasure. See ya later Kitty Kat," Anne said and gave a
single fingered wave. She then paused for a moment. "You're
having a good life, I can see that. All of the others too who were
involved in that Fury business way back?" Kat saying thank you
to her meant so much that she could hardly speak.
Kat nodded slowly, wondering why she was asking.
'How much do they really know' Anne thought and decided to
ask the question, "Ever wonder if Dr Bexley was being straight
with you? Y'know about not being able to turn you back as you
were? Even your daughter, Elizabeth looks a lot like her."
"Sometimes I wonder, but that's all in the past now. As you say,
life is good to us. As for Elizabeth, we realized while she was
growing up that she was a direct clone of Dr Bexley. She's
much too clever and wilful, to be anything or anyone else. And
yes, she does look just like her, even though she wears her hair
softer. We were as angry as hell when we found out, but in the
end we realized we loved her anyway. You love people for who
they are, not where they came from, or who they may become."
Anne gave a smile, "As it should be," Kat always had a way of
summing things up. Feelings that had taken her years to come
to terms with Kat had touched on in those last few words. Anne
would miss her.
Kat turned and walked away, deep in thought. Maybe she was
right after all, who knew? Dr Baxter certainly wasn't saying. She
turned to watch Dr Baxter getting back into the dinghy.
"All the best 'hell bitch' and I hope it works for you this time," she
whispered to herself.
She then turned back to walk to the house. Besides, Cathline
and family would be arriving tomorrow afternoon. And there
was a wedding to finalize.
As she reached the top of the steps leading to the house she
turned once more to see the sun setting beneath the horizon.
Looking down she saw the dinghy disappearing into the
distance. She smiled to herself and went inside.
-- o -- o -- o --
Seventy five years later
-------------------------------
"Great Grandmother come HERE!" a small juvenile voice
insisted, and a young girl tugged at an old lady's long flowing
skirt.
"Not just yet child. I'll be with you soon," the old woman
promised.
"But I'm BORED!" the girl protested.
"Hush now. Great Grandma's needs to do this, before..," the old
woman's voice tailed off.
Knowing that when great grandma said she needed to do
something nothing could distract her from it, the child
scampered off to chase butterflies in the nearby flowerbeds.
The old woman straightened herself up and looked over the
expanse of graves that panned out in front of her. A tear formed
in her eye. Too many people and too many lives wasted. Her
focus shifted down to the two large, marble headstones that
were in front of her. She read them once again
"Matthew Stephens Jane 'Kat' Stephens
1969-2067 1972-2073
True love knows no boundaries."
She had had so much to say to them; so much she wanted to
tell them, but now even thirty years after their deaths she didn't
know what to say. They'd never known of the wonderful life
she'd had with Mark, of the two children she'd borne him,
nor that she was a great, great grandmother to three more.
She hoped, no she knew they'd be happy for her and that, in
the end was all that mattered.
She turned her head to briefly check if Cathline Jane was still
ok, and saw that she was. She was using a twig to try and dig
out a worm that had had the temerity to escape her clutches.
She saw Cathline Jane look at her hand and concentrate. Within
a few seconds it had reformed into a scoop, perfect for digging
out worms with. She sighed, she'd told Cathline Jane hundreds
of times not to play around with her 'gift', but as usual it
had gone in one ear and out the other. Still, Cathline Jane
would learn soon enough, just as her own children had.
In the corner of her eye she saw another figure walking towards
her. Her eyes took a moment to register, but as soon as she
saw the graying auburn hair and the tall but still slender frame
she knew who it was. The figure noticed her and speeded up in
order to reach her.
"Hello Mother," the figure said.
The old woman was staggered! How did she know!
"I know what you are thinking. I should do. I've thought like you
for the past one hundred years. I know what today is and I know
that only one person would be here at my parents graveside
today. Only one person would never miss this day. That person
is you."
"Pray tell, what day do you think it is?" the old woman asked.
"It's hundred years since you placed me inside Kat isn't it? "
"A hundred years eh? That's a long time, a very long time.." The
old woman's voice trailed away, as if drifting into past memories.
The old woman continued. "Do I look over a hundred and thirty
years old?
"Don't deny it mother. I know it's you!"
"If you say so. Tell me why did you come here? Was it to meet
me?"
"You know it was, and that was also why you came too. I
wanted to say thank you."
"Thank you for what?"
"For giving me the chance to live. Without you I would not be
here. It took me years to work out how I was cured, but
eventually I did it. 'Cold boot' huh. Primitive nowadays but
effective all the same. Thanks to you I would have never known
the love of a good man and the joy of having children of my
own."
"It's not me you should be thanking, it's them," the old woman
nodded towards the gravestones.
"One thing they never realized was that without you there would
be no them."
"True love will always find a way. I once believed that all love
was unrequited, but I now see that was a mistake. I have known
what it is to love and to be loved, and as I near the end of my
life I see that as my greatest achievement. Forget about saving
oceans. That was nothing compared to what Mark and I shared
for so many years. I am so proud of you. I watched you grow up,
have your own children, and then become a grandmother yourself.
There wasn't a day that went past when I didn't thank God for
you, or pray for your happiness," the old woman's voice tailed
off, lost in a myriad of memories.
"It was you who came to visit us, just before my wedding wasn't
it? Of course you were Dr Anne Baxter then but I knew. Kat did
too. She never said anything to anybody but looking back on it I
see now that she knew it was you. You came to say goodbye
didn't you?"
The old woman's face dropped and a certain sparkle slowly
faded from her eyes, "Listen. I have so little time left. I can feel
my body slowly breaking down almost by the day. I'm paying the
price for stopping the Guild in the way I did so many years ago.
Cathline-Jane over there doesn't know it but soon Great Great
Grandma Elizabeth Anne will be gone and that will be that. I
want to spend the few weeks remaining to me with my family.
Tell me what are your intentions?"
"I want to be there. I want to be there at the end. I know Mom
and Dad would want to be there if they could."
The old woman gave a smile, leant in towards the figure and
whispered in her ear. The lady nodded in agreement and
whispered back "I promise."
-- o -- o -- o --
Three weeks later
------------------------
"I'm not too late am I?" the woman said breathlessly.
A nurse, looking tired and fatigued as though she had been
waiting up all night shook her head, "She stopped me from
going, she forbade me to leave until you came."
"How is she?"
"I'm amazed she's hung on this long. I'll say one thing for her,
she's a survivor. I wanted to give her some help by putting her
on bio-support, but she refused. You'd better go in, there's not
much time." The nurse gestured for the woman to follow her.
"I knew you'd come," the woman in the bed rasped. She was a
pale imitation of the woman at the graveside a few weeks a go.
Her hair had thinned and her skin was a gray deathly pallor.
Some other people who Elizabeth assumed was her family
stood around the bed. An elderly woman looked at Elizabeth
and mouthed "Sister," by her side was an older looking man. He
turned to Elizabeth, smiled and mouthed, "Brother."
Elizabeth held the old lady's hand to her lips and kissed it,
"Goodbye mother" she whispered softly. The old woman smiled
back and Elizabeth felt the hand go limp, and then realizing
what had happened started to sob softly. Her younger brother
and sister moved in to comfort each other and the first moment
of emotion they had ever shared was that of grief.
After one hundred and forty years of life Dr Elizabeth Anne
Bexley was gone.
Elizabeth lovingly rested Dr Bexley's hand back on her body and
turned to leave. She took one look back at her peaceful face
and gave a smile, this time there would be no faked suicides,
visits for a wedding or narrow escapes. She thought of the little
girl playing in the graveyard, of the memories of her own family
growing, playing and finally leaving to lead their own lives. Her
mother had been right. It had been worth it, even in the times of
pain and struggle true love knows no limitations or barriers. It
always prevails and knows no boundaries.
-- o -- o -- o --
Two weeks later.
-----------------------
Elizabeth stood by the quayside and watched Dr Bexley's family
carry a lit torch to a large wooden boat. Her body had been
loaded up onto the deck of the boat and wrapped down onto an
ornate table. Flowers from all over world littered the deck,
forming a floral carpet that seemed to shine with every color
imaginable. A band and choir stood ready; as Dr Bexley's son
and daughter, Elizabeth's brother and sister walked towards the
boat each carrying a wooden road wrapping in cloth. The man
took out a small lighter and lit the torch. He waited for a few
moments before throwing the burning torch onto the deck. The
woman passed her torch to him and he lit it for her and passed it
back again. She threw it with all her might and it landed on the
stern of the boat. As they slowly started to walk away the band
started to play one of Dr Bexley's favorite hymns.
"Before the throne of God above
I have a strong and perfect plea
A great high priest who's name is love
Who ever lives and pleads for me
My name is graven on his hands
My name is written on his heart
I know that while in heaven he stands
No tongue can bid me thence depart
No tongue can bid me thence depart"
She felt a squeeze on her hand as Alex sought to give her
comfort. Over the years Alex had been a source of strength,
comfort and love. He'd been an ideal father to her two children,
and now just having him there, holding her hand made her feel
safe and secure. She closed her eyes and listened to the choir
sing the refrain.
"My name is graven on his hands
My name is written on his heart
I know that while in heaven he stands
No tongue can bid me thence depart
No tongue can bid me thence depart"
The burning boat was gently pushed away from the quayside
using large wooden poles. Underneath the boat small electric
motors ensured the boat wouldn't float back into shore and so
the boat gradually powered it's self away. Elizabeth saw the
flames start to lick up the mast and around the table. Smoke
began to billow out as the fire caught hold.
"When Satan tempts me to despair,
And tells me of the guilt within,
Upward I look and see him there
Who made an end to all my sin
Because the sinless savior died
My sinful soul is counted free;
For God the just is satisfied
To look on him and pardon me
To look on him and pardon me"
The fire had really taken hold, and now the flames masked the
table and nearly the whole deck of the boat. Smoke now
consumed the sky surrounding the boat. It surely wouldn't be
too long before the whole deck was burned thru.
"Behold him there! The risen Lamb
My perfect spotless righteousness
The great unchangeable I AM
The king of glory and of grace!
One with himself I cannot die
My soul is purchased with his blood
My life is hid with Christ on high
With Christ, my savior and my God
With Christ, my savior and my God"
The boat was now almost all in flames and Elizabeth knew it
was only a matter of time before the fire burnt it's way into the
hold of the boat and it started to sink. By that time the small boat
would be far out to sea, taking with it the body of an exceptional
woman, her namesake, her soul mate and her mother. It was so
fitting that her final resting place would be the ocean which she
had done so much to save. She closed her eyes and listened to
the last refrain of the hymn.
"One with himself I cannot die
My soul is purchased with his blood
My life is hid with Christ on high
With Christ, my savior and my God
With Christ, my savior and my God"
Deep down she knew she would see Dr Bexley again and the
words of the hymn filled her with hope. The words reminded her
that there was always hope, always love and always
forgiveness, even for people like her. It was, she decided, as
good a lesson to learn as any. Kat, Cathline, and Matthew would
have been proud of her. Elizabeth gave Alex's hand another
squeeze and snuggled close to him. She felt him draw her
closer and together they watched as the boat, still burning
fiercely, drifted off into the distance.
END
Please let me know of any comments you have on this story.
Music And Voice Tracks
Fithos Lusec Wecos Vinosec Nobuo Uematsu
Epilogue From Z'hadum Andreas Katsulas(G'kar)
The Outside Cheryl Crow
Beauty Dies Young Lowgold
Fountain of Sighs GT Interactive(Unreal Tournament)
The Queen Of Hollywood The Corrs
The last Domino Genesis
I want to know what love is Foriegner
Incubus Marillion
I don't wanna fall in love Chris Isaak
Porcelin Moby
Empty Rooms Gary Moore
Before The Throne Of God. Charitie L Bancroft 1841-1892
Now we are free Hans Zimmer & Lisa Gerrard
