Back to ASC 128 Home Page

Genetics for Dummies
Dr. Richard Wilkens
Dowling College
May 1999
  1. Our place in the universe
    1. We, and all living things, exist…
      1. on a small planet
      2. around a middling yellow star
      3. found in an unremarkable solar system
      4. located in a rather ordinary galaxy among 100 billion other galaxies.
    2. Possible conclusion 1: we are insignificant, dwarfed by the immense power and size of the universe. We, and all living things, are simply bundles of low energy carbon, nitrogen, and oxygen in a universe with 1,000,000,000,000,000,000 stars, each one burning with the force of countless fusion bombs exploding each and every second. "We are but an ant walking across a desert."
    3. Possible conclusion 2: The ant is the greater wonder by far than the desert! For in many, many ways the universe is immensely uniform, simple, monotonous. If we measure significance not in raw power not in sheer size, but rather in intricacy and complexity, then perhaps life is the greatest achievement in all the universe.
  2. The complexity of life
    1. Indeed, life is complex and diverse: from the great blue whale to the magnificent single-celled organisms that populate streams and ponds. From the lions that roam the Serengeti to the carnivorous plants found right here on Long Island. This planet is a riot of complexity. 4-10 millions species on this planet. Many other that are no longer with us.
    2. Each species is itself a complex and intricate assemblage of functional units. Each of us here posses, in our brains, a level of complexity that is likely unmatched in the entire universe.
  3. Common threads to all living things
    1. Carbon is the building block to all life
      1. Why? Because carbon can form a nearly infinite number of complex molecules
      2. Diamonds to buckyballs to DNA
    2. Four general types of organic (carbon-based) molecules for all living things
      1. Carbohydrates: sugar, starch
      2. Lipids: fat, cholesterol
      3. Nucleic Acids: DNA, RNA (later)
      4. Proteins à thousands of different kinds
    3. Special proteins, called enzymes, do all of the work in living things
      1. What is a protein?
        1. Made up of a linear sequence of amino acids
        2. There are 20 different kinds of amino acids found in living things
        3. If the strand of amino acid molecules gets long…
        4. It begins to ball up into a three dimensional structure.
        5. Lock and key model of enzyme action
      2. What do enzymes do? à Everything. They are little machines that run, maintain, and assemble your body! They…
        1. digest food
        2. build new body material
        3. cause muscles to contract
        4. allow for nervous signals to be transmitted
      3. How to replicate yourself? à build all of the appropriate enzymes, machines. If you wanted to replicate yourself, one strategy would be to build all of the important machines, enzymes, that are responsible for assembling your body. If you have all of the right machines then you could do the job.
    4. DNA holds the instructions for building the machines
      1. Deoxyribonucleic acid, DNA: thousands, and in humans, hundreds of thousands of repeating units of nucleic acids
      2. The important component of DNA: Thymine, Adenine, Guanine, and Cytosine
        1. EVERY living organism uses ONLY these four bases as the foundation of the genetic code
        2. Bacteria, humans, slugs, slime mold, redwood trees: SAME CODE à A, T, G, and C in different arrangements.
      3. TTAAAATCCATATTACAGCCCTTAAATACGGGTGCA
        1. How can this string of letters be translated into the instructions for building the necessary machines, the enzymes, that build and maintain us?
        2. We need to rewrite the string above…
      4. TTA AAA TCC ATA TTA CAG CCC TTA AAT ACG GGT GCA
        1. Notice that the bases put into groups of three
        2. Each group is called a codon
        3. Each codon codes for a specific amino acid
          1. What is an amino acid? à the building block of proteins and therefore enzymes!
          2. E.g. AAA codes for a type of amino acid called phenylalanine.
          3. There is a unique codon for each of the 20 amino acids.
        4. So this string of bases codes for a strand of 12 amino acids
        5. 1000s of bases codes for a very long string of amino acids à protein à enzyme. If you have a string of bases that is thousands of units long, you have a code for an amino acid that is thousands of units long à you have a code for a complex three dimensional protein, an enzyme.
      5. What is a gene?
        1. A length of DNA that codes for one enzyme.
        2. One gene = one enzyme (protein)
        3. So what does it mean when we talk about a gene for blue eyes?
          1. It means, that the gene for blue eyes is REALLY the gene that codes for the machine, the enzyme, that assembles and maintains the blue eyes.
        4. Humans are complex animals, we require many, many, many little machines to keep us running properly à we need lots of different enzymes à we need lots of different genes then à we have a huge genome à thus, the human genome project!!!
      6. Remember the code is universal, so genes from humans, when inserted into bacteria will be expressed.
        1. Insulin production today.
        2. Of course the opposite may be possible too, genes from other organisms inserted into the human genome: All living things share the same code!
  4. How do traits get passed on in humans?
    1. We do not have one long strand of DNA
    2. Our genes are contained on 46 chromosomes
      1. Each chromosome contains thousands of genes à each gene codes for an enzyme
    3. Actually we have 23 pairs of chromosomes.
      1. We get one set from our mother
      2. We get one set from out father
      3. That would be why sex is important.
      4. Homologous pairs: draw a pic.
    4. Both your mother and father give you a gene for say eye color
      1. But they don’t necessarily give you the same form of that gene
      2. Alternate forms of a gene are called alleles
      3. Father à blue eye allele; Mother à brown eye. For instance, your mother may give you an allele of the eye color gene that codes for a blue eye and your father may give you an allele that codes for a brown eye.
      4. Alleles code for enzymes that bring about eye color. To be consistent with earlier notes, your mother may give you an allele of the eye color gene that codes for an enzyme that is responsible for assembling and maintaining blue in an eye, while your father may give you an allele that codes for an enzyme that is responsible for assembling and maintaining brown color in an eye.
      5. Sometimes one allele is expressed more than another
        1. Dominant expressed
        2. Recessive unexpressed
      6. But, if you carry a recessive allele, even if it is not expressed, you still have a 50% chance of passing that allele to your kids.
      7. Each of us has up to two lethal recessive alleles à if we didn’t have a dominant allele matched up with it, we would die.
      8. If you knew you had this recessive allele, would you want to know? One of the many ethical questions that face us.