Applications & Technologies
Recombinant DNA Technologies

 











     
  Summary Outline of Technology Info:

     A.  Plasmids
           1.  Structure
           2.  Function
           3.  Recombinant DNA Procedure
           4.  Insulin Example 

     B.  Restriction Enzymes
           1.  Description
           2.  Methylation
           3.  Recognition Sequences
           4.  Production of gDNA
           5.  Blunt vs. Sticky Ends

     C.  Oligonucleotides
           1.  Structure
           2.  Probes

     D.  Vectors
           1.  Purpose
           2.  Size Restrictions
           3.  Plasmid vs. Lambda 
           4.  Recombinant DNA Procedure

     E.  Gel Electrophoresis
           1.  Purpose
           2.  Components
           3.  Analysis
           4.  Sample Gel Electrophoresis

A.  Plasmids
           1.  Structure
- self-replicating ring of DNA, containing 2-30 genes, found in bacterial cells

                
          
        2.  Function
- plasmids can be transferred quite easily from one bacterium through another in a process called transformation; therefore, they are used frequently in Recombinant DNA applications

** For more information on transformation, click on the Recombinant DNA Applications link below.

                               

           3.  Recombinant DNA Procedure
- steps to incorporate a foreign DNA sequence into a plasmid
                a.  Cut open the plasmid
                b.  Splice other gene(s) into the plasmid
                c.  Use the recombined plasmid to make more copies of the inserted gene and gene product

           4.  Insulin Example
- bacterial plasmid modified by the addition of the insulin gene
                                        a.  Human insulin gene inserted into bacterial plasmid using the Recombinant DNA Procedure outlined above.
                b.  Every time bacterium reproduces, more insulin gene (and insulin) produced.
                c.  This insulin can be recovered and purified for use by diabetic patients.


     B.  Restriction Enzymes
           1.  Description
- enzymes produced by bacteria in order to cut out foreign DNA that may have been introduced by other bacteria

           2.  Methylation
- bacteria methylate, or add methyl groups (CH3) to their own DNA so as to protect it from excision by restriction enzymes

           3.  Recognition Sequences
- sequences of DNA that are 4-8 base pairs in length; these sequences must be located before a particular restriction enzyme is able to initiate a cut
                a.  90 different recognition sequences have been isolated from approximately 200 different restriction enzymes
                b.  Examples:

          
  HpaI                        EcoRI                    HindIII
   
5' GTTAAC 3'            5' GAATTC 3'        5' AAGCTT 3'
    3' CAATTG 5'            3' CTTAAG 5'        3' TTCGAA 5'


           4.  Production of gDNA
- gDNA, otherwise known as genomic DNA, contains all of the DNA fragments produced through the action of restriction enzymes

           5.  Blunt vs. Sticky Ends
- restriction enzymes can cut DNA sequences in these two different methods
                a.  Blunt ends - the DNA fragments produced have even, straight-cut ends

                                            
HpaI 
                                  
5' GTT  |||  AAC 3'
                                   3' CAA 
|||  TTG 5'

               
b.  Sticky ends - the DNA fragments produced have uneven, overlapping ends; this "cut and paste" technology allowed for the beginnings of Recombinant DNA Applications

               
EcoRI                                HindIII
      
5' G  |||  AATTC 3'               5' A  |||  AGCTT 3'
      
3' CTTAA  |||  G 5'               3' TTCGA  |||  A 5'


     C.  Oligonucleotides
           1.  Structure
- sequence of 12-20 DNA nucleotides produced in a laboratory machine

           2.  Probes
- oligonucleotides of a known sequence can be used to probe, or find, DNA to which it is complementary; therefore, with whatever segment the probe binds to, the DNA sequence can be determined

   
                            
Probe - AACCGGTT

DNA Sequence - CCGATTCATTGGCCAATATTACCGGA

Probe + Sequence - CCGATTCATTGGCCAATATTACCGGA
                                                
AACCGGTT

This allows the purple segment of the DNA sequence to be identified by base pairs due to complementary binding by the probe.


     D.  Vectors
           1.  Purpose
- vectors are used to incorporate and produce gDNA or oligonucleotides in large numbers (for instance it could be used to produce many copies of a particular gene, similar to the insulin example above)

           2.  Size Restrictions
- most vectors can contain DNA inserts of up to 4,000 base pairs in length

           3.  Plasmid vs. Lambda 
                a.  Plasmid
- due to the small size of a plasmid itself, it can only contain short DNA inserts of a couple thousand base pairs
                b.  Lambda bacteriophage - this larger vector can be used to incorporate inserts of up to 20,000 base pairs; since Lambda is a bacterial virus, every time the virus replicates, so does the insert

           4.  Recombinant DNA Procedure
- steps to follow in order to insert a DNA segment into a vector
                a.  Cut vector with restriction enzyme
                b.  Cut insert with the same restriction enzyme
                c.  Use DNA Ligase to join the insert to the vector
                d.  Multiple copies of the vector are produced through the action of bacteria (plasmid) or viruses (Lambda)
                e.  Cut the vector with the same restriction enzyme to remove the inserts.
                f.  Separate the inserts from the remaining gDNA using gel electrophoresis (described below).

** To see a diagram of the Recombinant DNA Procedure described above, click on the link below.

                           


     E.  Gel Electrophoresis
           1.  Purpose
- technique that separates DNA fragments of different sizes after they have been cut with restriction enzymes

           2.  Components
   
             a.  gDNA - segments of DNA that have previously been cut by restriction enzymes
                b.  Agarose gel - substance with approximately the same consistency as jello through which the gDNA segments will migrate based on their size
                c.  Electric Current - the gDNA segments are negatively charged due to the presence of phosphate, thus they will migrate downward through the gel towards the positive electric current

           3.  Analysis
- after the gDNA has migrated through the gel for several hours (through the application of electricity), the gel must be stained and analyzed
                a.  gDNA migrates by size through the agarose gel
                b.  Large gDNA segments will remain close to the top of the gel
                c.  Small gDNA segments will travel to the bottom of the gel
                d.  Due to this separation pattern, segments of DNA (probes, oligonucleotides) can be recovered by this technique if their nucleotide size is known.


TOP - Negative Electric Charge


   ----------      
  
    ----------
    ----------

    ----------
    ----------
    ----------

BOTTOM - Positive Electric Charge


        Analysis of Gel by gDNA Size (largest to smallest):
                                   
Purple
                
                    Blue
                                   
Orange
                
                    Green
                
                    Brown
                
                    Black

           4.  Sample Gel Electrophoresis:



To test your knowledge about Recombinant DNA Techniques, click on the Technology Questions Link at the top of this page.  After you answer the questions, be sure to check your responses by clicking on the Technology Answers Link.


                            |Home| |Genetics| |Standardized Exams|
                        |Ask a Question| |Related Links| |Site Index|